Previous Contig 011332:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005N02Sequence346018443390011332 (2)sp|O22478|IMA_LYCES4e-06Importin alpha subunit (Karyopherin alpha subunit) (KAP alpha).>pir|T04329|T0432
JMSF005N04Sequence368004747 (2)420011332 (2)sp|O22478|IMA_LYCES6e-07Importin alpha subunit (Karyopherin alpha subunit) (KAP alpha).>pir|T04329|T0432

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF005N02+ GGTGAGCTTGTACATTCAAATGACGAGGAAGTCCTGAC
rJMSF005N04+ ACCGGAGGTTCTACCTTACTCCGGTGAGCTTGTACATTCAAATGACGAGGAAGTCCTGAC
                      ____________________________________________________________
consensus ACCGGAGGTTCTACCTTACTCCGGTGAGCTTGTACATTCAAATGACGAGGAAGTCCTGAC
 
. : . : . : . : . : . :
rJMSF005N02+ AGATGAATGCTGGGCGAGAAAATCCAAGCTGTAATTGAGGCTGGAGTCTGTCACTGCCTT
rJMSF005N04+ AGATGAATGCTGGGCGAGAAAATCCAAGCTGTAATTGAGGCTGGAGTCTGTCACTGCCTT
                      ____________________________________________________________
consensus AGATGAATGCTGGGCGAGAAAATCCAAGCTGTAATTGAGGCTGGAGTCTGTCACTGCCTT
 
. : . : . : . : . : . :
rJMSF005N02+ GTTGAGCTTCTACCGTGAGAATTAGATTTTAATTTCTATCTTTTATAAACTCAAAAGGAT
rJMSF005N04+ GTTGAGCTTCTACCGTGAGAATTAGATTTTAATTTCTATCTTTTATAAACTCAAAAGGAT
                      ____________________________________________________________
consensus GTTGAGCTTCTACCGTGAGAATTAGATTTTAATTTCTATCTTTTATAAACTCAAAAGGAT
 
. : . : . : . : . : . :
rJMSF005N02+ CCTTNTATGCAAATCCAACGACATTGGATGTACCAACAACTGAACCATCCTTATACAACA
rJMSF005N04+ CCTTCTATGCAAATCCAACGACATTGGATGTACCAACAACTGAACCATCCTTATACAACA
                      ____________________________________________________________
consensus CCTTCTATGCAAATCCAACGACATTGGATGTACCAACAACTGAACCATCCTTATACAACA
 
. : . : . : . : . : . :
rJMSF005N02+ GTATGGTTAGGATTTCTCCATCATGGGCTATATTTTTCACAGTTAAACACTATCTTTGTC
rJMSF005N04+ GTATGGTTAGGATTTCTCCATCATGGGCTATATTTTTCACAGTTAAACACTATCTTTGTC
                      ____________________________________________________________
consensus GTATGGTTAGGATTTCTCCATCATGGGCTATATTTTTCACAGTTAAACACTATCTTTGTC
 
. : . : . : . : . : . :
rJMSF005N02+ TCCTTGTAGATATATATCCTTCATATTGTAGACCAAATATATGGCATTGTAAAGCTCNGC
rJMSF005N04+ TCCTTGTAGATATATATCCTTCATATTGTAGACCAAATATATGGCATTGTAAAGCTCTGC
                      ____________________________________________________________
consensus TCCTTGTAGATATATATCCTTCATATTGTAGACCAAATATATGGCATTGTAAAGCTCTGC
 
. : . : . : . : . : . :
rJMSF005N02+ CTGAACTTTAAATAATGGCAGCATTTGGTATCTAACACCATATTGACTCTGA
rJMSF005N04+ CTGAACTTTAAATAATGGCAGCATTTGGTATCTAACACCATATTGACTCTGAATGAACAT
                      ____________________________________________________________
consensus CTGAACTTTAAATAATGGCAGCATTTGGTATCTAACACCATATTGACTCTGAATGAACAT