Previous Contig 011330:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002P07Sequence255011330 (7)732011330 (7)gb:AY004241_15577416e-71Glycine max phosphoglycerate mutase-like protein (PGM) mRNA, complete cds.
JMSF005L21Sequence317011330 (7)461011330 (7)gb:AY004241_15577414e-26Glycine max phosphoglycerate mutase-like protein (PGM) mRNA, complete cds.
JMSF039C05Sequence670011330 (7)gb:AY004241_15577411e-50Glycine max phosphoglycerate mutase-like protein (PGM) mRNA, complete cds.410011330 (7)gb:AY004241_15577414e-49Glycine max phosphoglycerate mutase-like protein (PGM) mRNA, complete cds.
JMSF041O05Sequence754020117gb:AX647825_14725400.003Sequence 2017 from Patent EP1270724.633011330 (7)gb:AY004241_15577418e-60Glycine max phosphoglycerate mutase-like protein (PGM) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF002P07- GGGAGAC
JMSF039C05- GAC
                      ____________________________________________________________
consensus GGGAGAC
 
. : . : . : . : . : . :
JMSF002P07- TAAACTGAGACAAAAACTGAAACGCAGATCCGGCTGCCGCTATGACAGATAGTGTCGCCA
JMSF039C05- TAAACTGAGACAAAAACTGAAACGCAGATCCGGCTGCCGCTATGACAGATAGTGTCGCCA
                      ____________________________________________________________
consensus TAAACTGAGACAAAAACTGAAACGCAGATCCGGCTGCCGCTATGACAGATAGTGTCGCCA
 
. : . : . : . : . : . :
JMSF002P07- ATTGTTTATTATATTTTCAATTTGGAAAAGTGCAATTCCTATTCCGGAACTATTCTGATT
JMSF039C05- ATTGTTTATTATATTTTCAATTTGGAAAAGTGCAATTCCTATTCCGGAACTATTCTGATT
                      ____________________________________________________________
consensus ATTGTTTATTATATTTTCAATTTGGAAAAGTGCAATTCCTATTCCGGAACTATTCTGATT
 
. : . : . : . : . : . :
JMSF002P07- CTACCGCTATTGCTCTCACTCCGAACCTCCGCTCCAGAACGTCAACGCACCTCCACCTCC
JMSF005L21- CCGCTATTGCTCTCACTCCGAACCTCCGCTCCAGAACGTCAACGCACCTCCACCTCC
JMSF039C05- CTACCGCTATTGCTCTCACTCCGAACCTCCGCTCCAGAACGTCAACGCACCTCCACCTCC
                      ____________________________________________________________
consensus CTACCGCTATTGCTCTCACTCCGAACCTCCGCTCCAGAACGTCAACGCACCTCCACCTCC
 
. : . : . : . : . : . :
JMSF002P07- AACTCCGACGCTCCTCTTCTCCGGTAGTTTCTCTTCCGTCTCGCTCTCGCTCCGCCGCCT
JMSF005L21- AACTCCGACGCTCCTCTTCTCCGGTAGTTTCTCTTCCGTCTCGCTCTCGCTCCGCCGCCT
JMSF039C05- AACTCCGACGCTCCTCTTCTCCGGTAGTTTCTCTTCCGTCTCGCTCTCGCTCCGCCGCCT
                      ____________________________________________________________
consensus AACTCCGACGCTCCTCTTCTCCGGTAGTTTCTCTTCCGTCTCGCTCTCGCTCCGCCGCCT
 
. : . : . : . : . : . :
JMSF002P07- CTCGCTGC
JMSF005L21- CTCGCTGCTCTTCTTCTCTCTTCTCTG
JMSF039C05- CTCGCTGCTCTTCTTCTCTCTTCTCTGATATGGATGCCTCCGGGGGTCAGAGTGTCTATC
                      ____________________________________________________________
consensus CTCGCTGCTCTTCTTCTCTCTTCTCTGATATGGATGCCTCCGGGGGTCAGAGTGTCTATC
 
. : . : . : . : . : . :
JMSF039C05- CTCTGCACAGATGTAAAACGATCCACCTGGTGAGGCATGCTCAGGGATTTCACAATGTAG
                      ____________________________________________________________
consensus CTCTGCACAGATGTAAAACGATCCACCTGGTGAGGCATGCTCAGGGATTTCACAATGTAG
 
. : . : . : . : . : . :
JMSF039C05- AAGGAGAAAAGGACAACAATGCATACCTCTTACCACACCTTTTTGATGCAAATCTTACCC
                      ____________________________________________________________
consensus AAGGAGAAAAGGACAACAATGCATACCTCTTACCACACCTTTTTGATGCAAATCTTACCC
 
. : . : . : . : . : . :
JMSF039C05- CTCTTGGTTGGCAGCAGGTGGATAATCTACGCAAACATGTTAACTCATCCGGTCTTTCTA
                      ____________________________________________________________
consensus CTCTTGGTTGGCAGCAGGTGGATAATCTACGCAAACATGTTAACTCATCCGGTCTTTCTA
 
. : . : . : . : . : . :
JMSF039C05- AGAGGGTCGAATTGGTTGTCACTTCCCCATTGTTGAGGACTATACAAACAGCAGTTGGTG
rJMSF039C05+ TGTCACTTCCCCATTGTTGAGGACTATACAAACAGCAGTTGGTG
                      ____________________________________________________________
consensus AGAGGGTCGAATTGGTTGTCACTTCCCCATTGTTGAGGACTATACAAACAGCAGTTGGTG
 
. : . : . : . : . : . :
JMSF039C05- TCTTTGGGGGAGAAGGCTATGCTGATGACATACAAGGTCTTCCGTTAATGGTGACAAATG
rJMSF039C05+ TCTTTGGGGGAGAAGGCTATGCTGATGACATACAAGGTCTTCCGTTAATGGTGACAAATG
rJMSF002P07+ GGGGAGAAGGCTATGCTGATGACATACAAGGTCTTCCGTTAATGGTGACAAATG
                      ____________________________________________________________
consensus TCTTTGGGGGAGAAGGCTATGCTGATGACATACAAGGTCTTCCGTTAATGGTGACAAATG
 
. : . : . : . : . : . :
JMSF039C05- CTGGAAACAGTAGTCGACCTGCAATTTCAAGTCTAAATTGCCCTCCATTCCTGGCTATGG
rJMSF039C05+ CTGGAAACAGTAGTCGACCTGCAATTTCAAGTCTAAATTGCCCTCCATTCCTGGCTATGG
rJMSF041O05+ CATTCCTGGCTATGG
rJMSF002P07+ CTGGAAACAGTAGTCGACCTGCAATTTCAAGTCTAAATTGCCCTCCATTCCTGGCTATGG
                      ____________________________________________________________
consensus CTGGAAACAGTAGTCGACCTGCAATTTCAAGTCTAAATTGCCCTCCATTCCTGGCTATGG
 
. : . : . : . : . : . :
JMSF039C05- AGT
rJMSF039C05+ AGTTGTGCCGAGAACATACAGGGGTTCATTGGTGTGATAAAAGAAGAAACATCAGCGAGT
rJMSF041O05+ AGTTGTGCCGAGAACATACAGGGGTTCATTGGTGTGATAAAAGAAGAAACATCAGCGAGT
rJMSF002P07+ AGTTGTGCCGAGAACATACAGGGGTTCATTGGTGTGATAAAAGAAGAAACATCAGCGAGT
                      ____________________________________________________________
consensus AGTTGTGCCGAGAACATACAGGGGTTCATTGGTGTGATAAAAGAAGAAACATCAGCGAGT
 
. : . : . : . : . : . :
rJMSF039C05+ ATAAGCCTCAATTTCCAGCAATTGATTTCTCATTGATTGAACATAATGATGACATTCTGT
rJMSF041O05+ ATAAGCCTCAATTTCCAGCAATTGATTTCTCATTGATTGAACATAATGATGACATTCTGT
rJMSF002P07+ ATAAGCCTCAATTTCCAGCAATTGATTTCTCATTGATTGAACATAATGATGACATTCTGT
                      ____________________________________________________________
consensus ATAAGCCTCAATTTCCAGCAATTGATTTCTCATTGATTGAACATAATGATGACATTCTGT
 
. : . : . : . : . : . :
rJMSF039C05+ GGAAGGAGGACATTAGGGAGACAGATGAAGAACTTGCTACAAGGGGGATGAAGTTTTTAA
rJMSF041O05+ GGAAGGAGGACATTAGGGAGACAGATGAAGAACTTGCTACAAGGGGGATGAAGTTTTTAA
rJMSF002P07+ GGAAGGAGGACATTAGGGAGACAGATGAAGAACTTGCTACAAGGGGGATGAAGTTTTTAA
                      ____________________________________________________________
consensus GGAAGGAGGACATTAGGGAGACAGATGAAGAACTTGCTACAAGGGGGATGAAGTTTTTAA
 
. : . : . : . : . : . :
rJMSF039C05+ ACTGGTTGNTGNCGCGGAAGGAGAAGGAAATNNCAGNNGTTANTCACAGNGGATTCTTAA
rJMSF041O05+ ACTGGTTGTTGACGCGGAAGGAGAAGGAAATTGCAGTTGTTACTCACAGTGGATTCTTAA
rJMSF002P07+ ACTGGTTGTTGACGCGGAAGGAGAAGGAAATTGCAGTTGTTACTCACAGTGGATTCTTAA
rJMSF005L21+ GGAGAAGGAAATTGCAGTTGTTACTCACAGNGGATTCTTAA
                      ____________________________________________________________
consensus ACTGGTTGTTGACGCGGAAGGAGAAGGAAATTGCAGTTGTTACTCACAGTGGATTCTTAA
 
. : . : . : . : . : . :
rJMSF039C05+ TTC
rJMSF041O05+ TTCATACTCTAAGACAATTTGGAAATGACTGCAATCCAAATGTGAAGAATGAAATTTGCA
rJMSF002P07+ TTCATACTCTAAGACAATTTGGAAATGACTGCAATCCAAATGTGAAGAATGAAATTTGCA
rJMSF005L21+ TTCATACTGTAAGACAATTTGGAAATGACTGCAATCCAAATGTGAAGAATGAAATTTGCA
                      ____________________________________________________________
consensus TTCATACTCTAAGACAATTTGGAAATGACTGCAATCCAAATGTGAAGAATGAAATTTGCA
 
. : . : . : . : . : . :
rJMSF041O05+ GACCATTTAACAATTGTGAACTTCGGTCAATGGTTATTGTTGACAGATGTATGATTGGAT
rJMSF002P07+ GACCATTTAACAATTGTGAACTTCGGTCAATGGTTATTGTTGACAGATGTATGATTGGAT
rJMSF005L21+ GACCATTTAACAATTGTGAACTTCGGTCAATGGTTATTGTTGACAGATGTATGATTGGAT
                      ____________________________________________________________
consensus GACCATTTAACAATTGTGAACTTCGGTCAATGGTTATTGTTGACAGATGTATGATTGGAT
 
. : . : . : . : . : . :
rJMSF041O05+ CAGATACCCCCACAACCGACTATCCCGGTAAAATTCCCAGTGGATCAGACGTCCCAAGCG
rJMSF002P07+ CAGATACCCCCACAACCGACTATCCCGGTAAAATTCCCAGTGGATCAGACGTCCCAAGCG
rJMSF005L21+ CAGATACCCCCACAACCGACTATCCCGGTAAAATTCCCAGTGGATCAGACGTCCCAAGCG
                      ____________________________________________________________
consensus CAGATACCCCCACAACCGACTATCCCGGTAAAATTCCCAGTGGATCAGACGTCCCAAGCG
 
. : . : . : . : . : . :
rJMSF041O05+ AATGAAGCTATGATGCAGCTCAGCTCTGAAGCATCCAGATGATCTGCCTAGATGATTTGA
rJMSF002P07+ AATGAAGCTATGATGCAGCTCAGCTCTGAAGCATCCAGATGATCTGCCTAGATGATTTGA
rJMSF005L21+ AATGAAGNTATGATGCAGNTCAGNTNTGAAGCATCCAGATGATCTGCCTAGATGATTTGA
                      ____________________________________________________________
consensus AATGAAGCTATGATGCAGCTCAGCTCTGAAGCATCCAGATGATCTGCCTAGATGATTTGA
 
. : . : . : . : . : . :
rJMSF041O05+ ACTGCAGCAAACAGAGATTTTTTGGCTTTAGAGGCTTCGTTCGATTCATTTGGAGCATCA
rJMSF002P07+ ACTGCAGCAAACAGAGATTTTTTGGCTTTAGAGGCTTCGTTCGATTCATTTGGAGCATCA
rJMSF005L21+ ACTGCAGCAAACAGAGATTTTTTGGCTTTAGAGGCTTCGTTCGATTCATNTGGAGCATCA
                      ____________________________________________________________
consensus ACTGCAGCAAACAGAGATTTTTTGGCTTTAGAGGCTTCGTTCGATTCATTTGGAGCATCA
 
. : . : . : . : . : . :
rJMSF041O05+ TGTTTCTGTATCTCCCAACATGATTTTAAAAACAATTGAGATTTGTCAATCTAGAAGCAC
rJMSF002P07+ TGTTTCTGTATCTCCCAACATGATTTTAAAAACAATTGAGATTTGTCAATCTAGAAGCAC
rJMSF005L21+ TGNTTCTGTATCTCCCAACATGATTGTAAAAACAATTGAGATTTGTCAATCTAGAAGCAC
                      ____________________________________________________________
consensus TGTTTCTGTATCTCCCAACATGATTTTAAAAACAATTGAGATTTGTCAATCTAGAAGCAC
 
. : . : . : . : . : . :
rJMSF041O05+ GCACGCACCCATCAAAAC
rJMSF002P07+ GCACGCACCCATCAAAAC
rJMSF005L21+ GCACGCACCCATCAAAACTATATACCAGTGGCGTAATAANTCGNGCTGCCTANNACAAAT
                      ____________________________________________________________
consensus GCACGCACCCATCAAAACTATATACCAGTGGCGTAATAANTCGNGCTGCCTANNACAAAT