Previous Contig 011329:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005L14Sequence454000230 (38)gb:AF467728_18024302e-61Oryza sativa disease-resistent-related protein (RH3) mRNA, complete cds.270011329 (3)
JMSF005N16Sequence206004904 (2)gb:AY062623_15652796e-12Arabidopsis thaliana SOF1 protein-like protein (F20O9.130) mRNA, complete cds.341011329 (3)gb:AY062623_15652790.041Arabidopsis thaliana SOF1 protein-like protein (F20O9.130) mRNA, complete cds.
JMSF007K02Sequence476004904 (2)gb:AY062623_15652799e-57Arabidopsis thaliana SOF1 protein-like protein (F20O9.130) mRNA, complete cds.827011329 (3)gb:AY045624_15612152e-71Arabidopsis thaliana AT4g28450/F20O9_130 mRNA, complete cds.>gb:AY143901_1583358

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF007K02+ GCAAATGNGGATGTNACTGCTACAGCTATGATGCTAGAAAANTAATGAAGCT
                      ____________________________________________________________
consensus GCAAATGNGGATGTNACTGCTACAGCTATGATGCTAGAAAANTAATGAAGCT
 
. : . : . : . : . : . :
rJMSF007K02+ AAATGTGNTCACAGGATCATGTTTCCGCAGTGATGGATATAGACTATTCACCAACTGGTC
                      ____________________________________________________________
consensus AAATGTGNTCACAGGATCATGTTTCCGCAGTGATGGATATAGACTATTCACCAACTGGTC
 
. : . : . : . : . : . :
rJMSF007K02+ GTGAATTCGTTACTGGATCTTACGATAGAACAGTGAGAATATTCCATTATAATGGTGGTC
                      ____________________________________________________________
consensus GTGAATTCGTTACTGGATCTTACGATAGAACAGTGAGAATATTCCATTATAATGGTGGTC
 
. : . : . : . : . : . :
rJMSF007K02+ ACAGTAGGGAAATCTATCATACAAAGAGGATGCAAAGGGTGTTCTGTGTGAAGTTCAGTT
                      ____________________________________________________________
consensus ACAGTAGGGAAATCTATCATACAAAGAGGATGCAAAGGGTGTTCTGTGTGAAGTTCAGTT
 
. : . : . : . : . : . :
rJMSF007K02+ GCGATGCAAGTTACCTTATCTCAGGAAGTGATGATACCAACCTTCGTTTATGGAAAGCTA
                      ____________________________________________________________
consensus GCGATGCAAGTTACCTTATCTCAGGAAGTGATGATACCAACCTTCGTTTATGGAAAGCTA
 
. : . : . : . : . : . :
rJMSF007K02+ AAGCATCTGAGCAAATGGGAGTGCTTTTGCCCAGAGAACTTAGAAAGCATGAATATCACG
                      ____________________________________________________________
consensus AAGCATCTGAGCAAATGGGAGTGCTTTTGCCCAGAGAACTTAGAAAGCATGAATATCACG
 
. : . : . : . : . : . :
rJMSF007K02+ TGGCTCTCAAGAATCGTTTCAAGCATCTTCCTGGAATCAAACGCATTGACAGACATCGTC
                      ____________________________________________________________
consensus TGGCTCTCAAGAATCGTTTCAAGCATCTTCCTGGAATCAAACGCATTGACAGACATCGTC
 
. : . : . : . : . : . :
rJMSF007K02+ ACTTGCCCAAGGCAATATACAAGGCTTCTAATCTGAGACGGGAGATGACTGAATCAGAAA
                      ____________________________________________________________
consensus ACTTGCCCAAGGCAATATACAAGGCTTCTAATCTGAGACGGGAGATGACTGAATCAGAAA
 
. : . : . : . : . : . :
rJMSF005N16+ GCTAGAAAGAGAGCTCACAGCAGACCAGGCAGCATGCCAAACGAGCCAT
rJMSF007K02+ GGAAGAAGGAAGCTAGAAAGAGAGCTCACAGCAGACCAGGCAGCATGCCAAACGAGCCAT
                      ____________________________________________________________
consensus GGAAGAAGGAAGCTAGAAAGAGAGCTCACAGCAGACCAGGCAGCATGCCAAACGAGCCAT
 
. : . : . : . : . : . :
rJMSF005N16+ TACGTAAGAAAAGAATCATTCAAGAAGTTGAATGAGTGGCTGCTTCATCCTCCCTTACAC
rJMSF007K02+ TACGTAAGAAAAGAATCATTCAAGAAGTTGAATGAGTGGCTGCTTCATCCTCCCTTACAC
rJMSF005L14+ GCTTCATCCTCCCTGACAC
                      ____________________________________________________________
consensus TACGTAAGAAAAGAATCATTCAAGAAGTTGAATGAGTGGCTGCTTCATCCTCCCTTACAC
 
. : . : . : . : . : . :
rJMSF005N16+ AGTATTCTTTCACTCCTA-CCCTCGGGATAAAACCCAGAACTGAACCCATCAAGA-ACAT
rJMSF007K02+ AGTATTCTTTCACTCCTA-CCCTCGGGATAAAACCCAGAACTGAACCCATCAAGA-ACAT
rJMSF005L14+ AGTACTCNTTCACTCCTACCCCTCGGGATAAAACCCAGAACTGNACCCATCAAGACACNT
                      ____________________________________________________________
consensus AGTATTCTTTCACTCCTA-CCCTCGGGATAAAACCCAGAACTGAACCCATCAAGA-ACAT
 
. : . : . : . : . : . :
rJMSF005N16+ CTATTTTAGGGAGCTTAGAATCTATTTNGACAATCT-TTGTT-TTATAATTACATGTAAA
rJMSF007K02+ CTATTTTAGGGAGCTTAGAATCTATTTCGACAATCT-TTGTT-TTATAATTACATGTAAA
rJMSF005L14+ NTATTTTAGGGAGCTTAGAATCTATTTCGACAATCTCCTGTTNTTATAATTACATGTAAA
                      ____________________________________________________________
consensus CTATTTTAGGGAGCTTAGAATCTATTTCGACAATCT-TTGTT-TTATAATTACATGTAAA
 
. : . : . : . : . : . :
rJMSF005N16+ GGAACCAACACTCCTGCTTTAGCTTTAGATCTTTTGGTCTGGTTAAGATGATTGGTTTAG
rJMSF007K02+ GGAACCAACACTCCTGCTTTAGCTTTAGATCTTTTGGTCTGGTTAAGATGATTGGTTTAG
rJMSF005L14+ GGAACCAACACTCCTGCTTTAGCTTTAGATCTTCTGGTCTGGTTAAGATGATTGGTNTAG
                      ____________________________________________________________
consensus GGAACCAACACTCCTGCTTTAGCTTTAGATCTTTTGGTCTGGTTAAGATGATTGGTTTAG
 
. : . : . : . : . : . :
rJMSF005N16+ ATATAATATCAAACCAAACACAAA-CAGTTAACAATTTTGAACTCTTCCACC
rJMSF007K02+ ATATAATATCAAACCAAACACAAACCAGTTAACAATTTTGAACTCTTCCACC
rJMSF005L14+ ATATAATATCAAACCAAACACAAA-CAGTTAACAA-TTTGAACTCTTCCACCAATATTGT
                      ____________________________________________________________
consensus ATATAATATCAAACCAAACACAAA-CAGTTAACAATTTTGAACTCTTCCACCAATATTGT