Previous Contig 011328:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005L13Sequence374004735 (45)pir|S42583|S425833e-04phosphate translocator, chloroplast - common tobacco>gb:NTRNPHTR_1691752 Nicotia316011328 (2)
JMSF005N15Sequence238018445191011328 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF005L13+ ATGCTCCCACCTCGNCCT
                      ____________________________________________________________
consensus ATGCTCCCACCTCGNCCT
 
. : . : . : . : . : . :
rJMSF005L13+ ATTGNTAGTTAGTAGGTGCAAATCATGCAATCNGCTCATAATATGTTTTTTTGAGGAAGG
                      ____________________________________________________________
consensus ATTGNTAGTTAGTAGGTGCAAATCATGCAATCNGCTCATAATATGTTTTTTTGAGGAAGG
 
. : . : . : . : . : . :
rJMSF005N15+ GTTAAGTTTGCATGAAAAATGTTAC
rJMSF005L13+ CGNTGAACATGAACGGGAACCAGTGTCGTCCACTTGTTAAGTTTGCATGAAAAATGTTAC
                      ____________________________________________________________
consensus CGNTGAACATGAACGGGAACCAGTGTCGTCCACTTGTTAAGTTTGCATGAAAAATGTTAC
 
. : . : . : . : . : . :
rJMSF005N15+ CTTTTCTTTAGGAAGCAGTTCTAACTCTGCCCAAAATTGCGACTGGAAAATGCAAAGTAA
rJMSF005L13+ CTTTTCTTTAGGAAGCAGTTCTAACTCTGCCCAAAATTGCGACTGGAAAATGCAAAGTAA
                      ____________________________________________________________
consensus CTTTTCTTTAGGAAGCAGTTCTAACTCTGCCCAAAATTGCGACTGGAAAATGCAAAGTAA
 
. : . : . : . : . : . :
rJMSF005N15+ GAATGAGANGCCAGGCAACCAGTCAATAGTTTTGCAGATTTGCCCCCAGCGGGCGTCTTG
rJMSF005L13+ GAATGAGA-ACCAGGCAACCAGTCAATAGTTTNGCAGATTTGCCCCCA-CGGGCGTCTTG
                      ____________________________________________________________
consensus GAATGAGANGCCAGGCAACCAGTCAATAGTTTTGCAGATTTGCCCCCAGCGGGCGTCTTG
 
. : . : . : . : . : . :
rJMSF005N15+ AGTAGCCCAAATATTTGATNTTGAATATGGTTGTTCAACTTT
rJMSF005L13+ AGTAGCCCAAATATTTGATTTTGAATATGGTTGTTCAACTTTNTTATGGGGTTTTCTAAG
                      ____________________________________________________________
consensus AGTAGCCCAAATATTTGATTTTGAATATGGTTGTTCAACTTTNTTATGGGGTTTTCTAAG