Previous Contig 011321:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005G09Sequence450011321 (2)gb:AF492629_18049544e-32Capsicum annuum auxin-induced SAUR-like protein (upa5) mRNA, complete cds.349004546 (5)gb:AY088239_15732607e-20Arabidopsis thaliana clone 463 mRNA, complete sequence.
JMSF005G11Sequence243004701 (3)510011321 (2)gb:AF492629_18049543e-32Capsicum annuum auxin-induced SAUR-like protein (upa5) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF005G09- GGGAATTCATTCTACCCTATTTCCAAGGTTTCTACAAATCTTATTC
                      ____________________________________________________________
consensus GGGAATTCATTCTACCCTATTTCCAAGGTTTCTACAAATCTTATTC
 
. : . : . : . : . : . :
JMSF005G09- TCTTCCGATCCATTCAATCTCTCTCATCTCCATCTATTTTCTAAGTTAATATCATCATGA
                      ____________________________________________________________
consensus TCTTCCGATCCATTCAATCTCTCTCATCTCCATCTATTTTCTAAGTTAATATCATCATGA
 
. : . : . : . : . : . :
JMSF005G09- TCAGTTCAAAGAGGCTCATTAAGCTGGCCAGAAGATGGCAGAAATTTGCTGCCATCCGAA
rJMSF005G11+ AAGATGGCAGAAATTTGCTGCCATCCGAA
                      ____________________________________________________________
consensus TCAGTTCAAAGAGGCTCATTAAGCTGGCCAGAAGATGGCAGAAATTTGCTGCCATCCGAA
 
. : . : . : . : . : . :
JMSF005G09- GAAAGAGGATTTCATTTCCAAGTCTATATGATGATTCAGATAGCTGCACTACTAGTACTT
rJMSF005G11+ GAAAGAGGATTTCATTTCCAAGTCTATATGATGATTCAGATAGCTGCACTACTAGTACTT
                      ____________________________________________________________
consensus GAAAGAGGATTTCATTTCCAAGTCTATATGATGATTCAGATAGCTGCACTACTAGTACTT
 
. : . : . : . : . : . :
JMSF005G09- CTTCTGCAGTTTACAAGGGTCATTTCACTATCTACACTGCTGATCAGAAGCGGTTTGTTG
rJMSF005G11+ CTTCTGCAGTTTACAAGGGTCATTTCACTATCTACACTGCTGATCAGAAGCGGTTTGTTG
                      ____________________________________________________________
consensus CTTCTGCAGTTTACAAGGGTCATTTCACTATCTACACTGCTGATCAGAAGCGGTTTGTTG
 
. : . : . : . : . : . :
JMSF005G09- TCCCTCTGTCATATCTCGAGAATCATATCATTAGGCAACTCTTAAGTATGTCTGAAGAAG
rJMSF005G11+ TCCCTCTGTCATATCTCGAGAATCATATCATTAGGCAACTCTTAAGTATGTCTGAAGAAG
                      ____________________________________________________________
consensus TCCCTCTGTCATATCTCGAGAATCATATCATTAGGCAACTCTTAAGTATGTCTGAAGAAG
 
. : . : . : . : . : . :
JMSF005G09- AATTTGGACTTCCAAGCGATGGGCCAATTACACTACCATGTGATGCAGTCTTCATGGACT
rJMSF005G11+ AATTTGGACTTCCAAGCGATGGGCCAATTACACTACCATGTGATGCAGTCTTCATGGACT
                      ____________________________________________________________
consensus AATTTGGACTTCCAAGCGATGGGCCAATTACACTACCATGTGATGCAGTCTTCATGGACT
 
. : . : . : . : . : . :
JMSF005G09- ACATCATTTCACTTCTTAGCCGAGGTTTATCTAGAGA
rJMSF005G11+ ACATCATTTCACTTCTTAGCCGAGGTTTATCTAGAGAACTTGAGAANGCACTGCTCGTTT
                      ____________________________________________________________
consensus ACATCATTTCACTTCTTAGCCGAGGTTTATCTAGAGAACTTGAGAANGCACTGCTCGTTT
 
. : . : . : . : . : . :
rJMSF005G11+ CACNTACTTCTCATCGCTGTTCATCAGCTCCGTTACTCCGAAATCAGGAATTGCTAGTTT
                      ____________________________________________________________
consensus CACNTACTTCTCATCGCTGTTCATCAGCTCCGTTACTCCGAAATCAGGAATTGCTAGTTT
 
. : . : . : . : . : . :
rJMSF005G11+ GCNCATATTAATCTCAATAAATTTTGTAATATAAATGAGGATATATATTAGTTGTAGCTC
                      ____________________________________________________________
consensus GCNCATATTAATCTCAATAAATTTTGTAATATAAATGAGGATATATATTAGTTGTAGCTC