Previous Contig 011314:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF051H19Sequence598011314 (4)gb:AP003276_18270273e-53Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051508011089 (2)
JMFN014K03Sequence642011314 (4)pir|T02350|T023501e-56hypothetical protein T8F5.5 - Arabidopsis thaliana>gb:AE005173_894180 Arabidopsi
JMFS105C08Sequence619011314 (4)pir|T02350|T023502e-42hypothetical protein T8F5.5 - Arabidopsis thaliana>gb:AE005173_894180 Arabidopsi
JMSF004P13Sequence264018393sp|O49859|C824_SOYBN3e-10Cytochrome P450 82A4 (EC 1.14.-.-) (P450 CP9).>pir|T07749|T07749 probable cytoch298011314 (4)pir|T02350|T023506e-08hypothetical protein T8F5.5 - Arabidopsis thaliana>gb:AE005173_894180 Arabidopsi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF051H19+ GACAAATGTTCTCATCCTCAAGCTCACCAAGCATTTG
                      ____________________________________________________________
consensus GACAAATGTTCTCATCCTCAAGCTCACCAAGCATTTG
 
. : . : . : . : . : . :
JMFF051H19+ TAAACTCAACAAAGCGTTTAAAGATTTACAAGACCCAGATAAGAGAAAAGCATTGGATGA
                      ____________________________________________________________
consensus TAAACTCAACAAAGCGTTTAAAGATTTACAAGACCCAGATAAGAGAAAAGCATTGGATGA
 
. : . : . : . : . : . :
JMFF051H19+ CAAAATAAAGCTCAAGGAGGAGCAGGAGGAAATGAAGGCAGATTTGCAAGCCATGCGTGA
                      ____________________________________________________________
consensus CAAAATAAAGCTCAAGGAGGAGCAGGAGGAAATGAAGGCAGATTTGCAAGCCATGCGTGA
 
. : . : . : . : . : . :
JMFF051H19+ AGCTGCACAGTGGAGACGTTTGCAAGGTATATCCATGGAGGGTGATGATATACTGTTAGA
                      ____________________________________________________________
consensus AGCTGCACAGTGGAGACGTTTGCAAGGTATATCCATGGAGGGTGATGATATACTGTTAGA
 
. : . : . : . : . : . :
JMFF051H19+ AACACCAAAAAGAGATGAATGGATGACAACCCTCCCTCCAGAAAGAAAACCTGGCCGCAT
                      ____________________________________________________________
consensus AACACCAAAAAGAGATGAATGGATGACAACCCTCCCTCCAGAAAGAAAACCTGGCCGCAT
 
. : . : . : . : . : . :
JMFF051H19+ GCCAATGTGTTCAACAACATTTAGCAAGAGTTCCAAGGAGGGGCGGGGTGATACTAGTGT
                      ____________________________________________________________
consensus GCCAATGTGTTCAACAACATTTAGCAAGAGTTCCAAGGAGGGGCGGGGTGATACTAGTGT
 
. : . : . : . : . : . :
JMFF051H19+ CTGGACAGATACTCCTTCAGATAGAGCACTGAAAGCCAAAATGAATTATGCTTCTAAAGA
JMFN014K03- TGCTTCTAAAGA
JMFS105C08- TGCTTCTAAAGA
                      ____________________________________________________________
consensus CTGGACAGATACTCCTTCAGATAGAGCACTGAAAGCCAAAATGAATTATGCTTCTAAAGA
 
. : . : . : . : . : . :
JMFF051H19+ ACAGGATACGAAAAGGGAAAATGCAGATAATGCTGCACTTGTGGATCAGTACAACAAGGC
JMFN014K03- ACAGGATACGAAAAGGGAAAATGCAG---ATGCTGAACTCGTGGATCAGTACAACAAGGC
JMFS105C08- ACAGGATACGAAAAGGGAAAATGCAG---ATGCTGAACTCGTGGATCAGTACAACAAGGC
                      ____________________________________________________________
consensus ACAGGATACGAAAAGGGAAAATGCAG---ATGCTGAACTCGTGGATCAGTACAACAAGGC
 
. : . : . : . : . : . :
JMFF051H19+ TAAACGATCAAAATCTTTGGTAGAAAAGCATCAAGAGAAAGGTGGGAGCAAGTCCAAGAA
JMFN014K03- TAACCGATCAAAATCTTTGGTAGAAAAGCATCAAGAGAAAGCTCGGAGCAAGTCCAAGAA
JMFS105C08- TAACCGATCAAAATCTTTGGTAGAAAAGCATCAAGAGAAAGCTCGGAGCAAGTCCAAGAA
                      ____________________________________________________________
consensus TAACCGATCAAAATCTTTGGTAGAAAAGCATCAAGAGAAAGCTCGGAGCAAGTCCAAGAA
 
. : . : . : . : . : . :
JMFF051H19+ AAAAGCAAAGCA
JMFN014K03- AAAAGCAAAGCAGGGGGAGGTGGAGAAAGAAGAATGGGAAGGAAACCATCCATGGAAACC
JMFS105C08- AAAAGCAAAGCAGGGGGAGGTGGAGAAAGAAGAATGGGAAGGAAACCATCCATGGAAACC
                      ____________________________________________________________
consensus AAAAGCAAAGCAGGGGGAGGTGGAGAAAGAAGAATGGGAAGGAAACCATCCATGGAAACC
 
. : . : . : . : . : . :
JMFN014K03- TTGGGATCGCGAAAAGGATTTGACGGCTGGAAGGCAAAGTGTGAAACTCGACGCCGAAAA
JMFS105C08- TTGGGATCGCGAAAAGGATTTGACGGCTGGAAGGCAAAGTGTGAAACTCGACGCCGAAAA
rJMSF004P13+ GGGATCGCGAAANGGATNCGACGGCTGGAAGGCAAAGTGTGAAACTCGACGCCGAAAA
                      ____________________________________________________________
consensus TTGGGATCGCGAAAAGGATTTGACGGCTGGAAGGCAAAGTGTGAAACTCGACGCCGAAAA
 
. : . : . : . : . : . :
JMFN014K03- TATGACAAAGGGTTTGACTTCCAGATTTTCTTCTGGGTCTTTCCAAAGGAACTTCCTCTA
JMFS105C08- TATGACAAAGGGTTTGACTTCCAGATTTTCTTCTGGGTCTTTCCAAAGGAACTTCCTCTA
rJMSF004P13+ TATGACAAAGGGTTTGACTTCCNGATTTTCTTCTGGGTCTTTCCAAAGGAACTTCCTCTA
                      ____________________________________________________________
consensus TATGACAAAGGGTTTGACTTCCAGATTTTCTTCTGGGTCTTTCCAAAGGAACTTCCTCTA
 
. : . : . : . : . : . :
JMFN014K03- GATGGCAAGGGTAAACACAACTTGTCTGGGAGAAAGCTTGAGGCTGCCCAGCAATATTGT
JMFS105C08- GATGGCAAGGGTAAACACAACTTGTCTGGGAGAAAGCTTGAGGCTGCCCAGCAATATTGT
rJMSF004P13+ GATGGCAAGGGTAAACACAACTTGTCTGGGNGAAAGCTTGAGGCTGCCCAGCAATATTGT
                      ____________________________________________________________
consensus GATGGCAAGGGTAAACACAACTTGTCTGGGAGAAAGCTTGAGGCTGCCCAGCAATATTGT
 
. : . : . : . : . : . :
JMFN014K03- CTTTGAATTTGATTGCTCCTTTTATC
JMFS105C08- CTTTGAATTTGATTGCTCCTTTTATCTAATTTTTCTTTCAACATCTTTATACAATTCAAA
rJMSF004P13+ CTTNGAATTTGATTGCTCCTTTTATCTAATTNTTCTTTCAACATCTTTATNCAATTCAAA
                      ____________________________________________________________
consensus CTTTGAATTTGATTGCTCCTTTTATCTAATTTTTCTTTCAACATCTTTATACAATTCAAA
 
. : . : . : . : . : . :
JMFS105C08- CTTTTCAAAATGAGAAATTGTATA-CAGAGTATATACTAATGTAAACTGCTCACA
rJMSF004P13+ CTTTNCAAAATGNGAAATTGTATACCAGAGTATNTCCTAATGTAAACTGCTCACATCCCG
                      ____________________________________________________________
consensus CTTTTCAAAATGAGAAATTGTATACCAGAGTATATCCTAATGTAAACTGCTCACATCCCG