Previous Contig 011309:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004L21Sequence300011309 (2)gb:AP003526_18304600.041Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054426011309 (2)gb:AY087514_15725456e-14Arabidopsis thaliana clone 36243 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF004L21- GACCTCAGCTCAATTCAAT
                      ____________________________________________________________
consensus GACCTCAGCTCAATTCAAT
 
. : . : . : . : . : . :
JMSF004L21- TCTTTCTTCATTCACTACAAAAGAAACGAAAAGATCATGGCAAAGTTGTCCAGATCAAAC
rJMSF004L21+ TCAAAC
                      ____________________________________________________________
consensus TCTTTCTTCATTCACTACAAAAGAAACGAAAAGATCATGGCAAAGTTGTCCAGATCAAAC
 
. : . : . : . : . : . :
JMSF004L21- GGGAAGAAAAAGAATGGCATGAACCTCAAGACAATGGTACAAATGTTTCAAAAGAGTTTT
rJMSF004L21+ GGGAAGAAAAAGAATGGCATGAACCTCAAGACAATGGTACAAATGTTTCAAAAGAGTTTT
                      ____________________________________________________________
consensus GGGAAGAAAAAGAATGGCATGAACCTCAAGACAATGGTACAAATGTTTCAAAAGAGTTTT
 
. : . : . : . : . : . :
JMSF004L21- TTAGCAGATCATCAGAGGTCATCCCTGAATGATTTTGACGAGTTCGAGAACTCCAAGGAT
rJMSF004L21+ TTAGCAGATCATCAGAGGTCATCCCTGAATGATTTTGACGAGTTCGAGAACTCCAAGGAT
                      ____________________________________________________________
consensus TTAGCAGATCATCAGAGGTCATCCCTGAATGATTTTGACGAGTTCGAGAACTCCAAGGAT
 
. : . : . : . : . : . :
JMSF004L21- GTGTCTAATGACGTTAAAGAAGGGCATTTCGCGGTGATGGAGGTGGACAATGAGAAGCGC
rJMSF004L21+ GTGTCTAATGACGTTAAAGAAGGGCATTTCGCGGTGATGGAGGTGGACAATGAGAAGCGC
                      ____________________________________________________________
consensus GTGTCTAATGACGTTAAAGAAGGGCATTTCGCGGTGATGGAGGTGGACAATGAGAAGCGC
 
. : . : . : . : . : . :
JMSF004L21- AAGAGATTGATTCTTCCTCTAAGTTGTTTAATGCACCCTTC
rJMSF004L21+ AAGAGACTGATTCTTCCTCTAAGTTGTTTAATGCACCCTTCATTNTTAAGGCTGTTGGAA
                      ____________________________________________________________
consensus AAGAGATTGATTCTTCCTCTAAGTTGTTTAATGCACCCTTCATTNTTAAGGCTGTTGGAA
 
. : . : . : . : . : . :
rJMSF004L21+ AAAGCTGCAGAGGAATATGGGTTCGAACATGAAGGCGCACTCATTCNTTCTTGCAGGCCA
                      ____________________________________________________________
consensus AAAGCTGCAGAGGAATATGGGTTCGAACATGAAGGCGCACTCATTCNTTCTTGCAGGCCA
 
. : . : . : . : . : . :
rJMSF004L21+ ATTGAATTGGAGAGGATTCTTGCCAAGCAATATATTGGAAAAGTAGATTGGAGTTCTTGT
                      ____________________________________________________________
consensus ATTGAATTGGAGAGGATTCTTGCCAAGCAATATATTGGAAAAGTAGATTGGAGTTCTTGT
 
. : . : . : . : . : . :
rJMSF004L21+ ACAACTCAAGAGCTTTTANGTTCAAATTAAATATNCAAGTGAATAGATCNGATTGTCCAA
                      ____________________________________________________________
consensus ACAACTCAAGAGCTTTTANGTTCAAATTAAATATNCAAGTGAATAGATCNGATTGTCCAA