Previous Contig 011308:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004L16Sequence341004639 (5)399011308 (4)gb:AC154033_17452615e-23Solanum demissum chromosome 5 clone PGEC132D05 map MAP_LOC, complete sequence.
JMSF014E06Sequence296004639 (5)720011308 (4)gb:AC154033_17452618e-56Solanum demissum chromosome 5 clone PGEC132D05 map MAP_LOC, complete sequence.
JMSF028M02Sequence266004639 (5)141011308 (4)
JMSF037M01Sequence256004639 (5)384011308 (4)gb:AC154033_17452611e-16Solanum demissum chromosome 5 clone PGEC132D05 map MAP_LOC, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF014E06+ ACAAGG
                      ____________________________________________________________
consensus ACAAGG
 
. : . : . : . : . : . :
rJMSF014E06+ GGTGAATGGGTTTGGACATAAAGTAACGGCAACTTGGAAAGTTACGATGAGAGGAATGTG
                      ____________________________________________________________
consensus GGTGAATGGGTTTGGACATAAAGTAACGGCAACTTGGAAAGTTACGATGAGAGGAATGTG
 
. : . : . : . : . : . :
rJMSF014E06+ ACTTGGTGATGGATTCACTATCATCTACTGTCAGATCGGGANGAAGTCGAGCCTNTCCCA
                      ____________________________________________________________
consensus ACTTGGTGATGGATTCACTATCATCTACTGTCAGATCGGGANGAAGTCGAGCCTNTCCCA
 
. : . : . : . : . : . :
rJMSF014E06+ TCCCTAGCAGTCGATGTTCCCTCCATTGTTGNTGAGAAGGATAAAGGCCTCAAAACTTGC
                      ____________________________________________________________
consensus TCCCTAGCAGTCGATGTTCCCTCCATTGTTGNTGAGAAGGATAAAGGCCTCAAAACTTGC
 
. : . : . : . : . : . :
rJMSF014E06+ CTAGAAGTGCCATAATCATCAATGCTGATTTCTTGTATAGCAGGAGGAGTCCACTGCTGA
                      ____________________________________________________________
consensus CTAGAAGTGCCATAATCATCAATGCTGATTTCTTGTATAGCAGGAGGAGTCCACTGCTGA
 
. : . : . : . : . : . :
rJMSF014E06+ GCAGGAGAGTTATCAGATGGGNTANTATAGTATGCACCAATACCATCAGATACAAGATAT
                      ____________________________________________________________
consensus GCAGGAGAGTTATCAGATGGGNTANTATAGTATGCACCAATACCATCAGATACAAGATAT
 
. : . : . : . : . : . :
rJMSF014E06+ TGATGATTCGTGAACNGGTTTCCCCTNGCCCAGCTTNTACTTTNTGTGCTGTTTGATGAA
rJMSF037M01+ TGATGAA
rJMSF004L16+ GCCCAGCTTCTACTTTCTCTGCTGTTTGATGAA
                      ____________________________________________________________
consensus TGATGATTCGTGAACNGGTTTCCCCTNGCCCAGCTTCTACTTTCTGTGCTGTTTGATGAA
 
. : . : . : . : . : . :
rJMSF014E06+ GNTGATGATCCATACAATTGGGCTCCATCATGAGACCCAANTGATAGAGCTTCAGATTGG
rJMSF037M01+ GNTGATGATCCATACAATTGGGNTCCATCATGAGANCCAAATGATAGAGCTTCAGATNGG
rJMSF004L16+ GCTGATGATCCATACAATTGGGCTCCATCATGAGACCCAAATGATAGAGCTTCAGATTGG
                      ____________________________________________________________
consensus GCTGATGATCCATACAATTGGGCTCCATCATGAGACCCAAATGATAGAGCTTCAGATTGG
 
. : . : . : . : . : . :
rJMSF014E06+ AACCGGAAGTCCCATCTTGTTGNTGGCGGGGAAAAGCTCGAATTAGTTCGCCAGTAAGGC
rJMSF037M01+ AACCGGAAGTNCCATNTTGTTGGTGGNGGGGAAAAGCTNGAATTAGTTCGCCAGTAAGGC
rJMSF004L16+ AACCGGAAGTCCCATCTTGTTGGTGGCGGGGAAAAGCTCGAATTAGTTCGCCAGTAAGGC
                      ____________________________________________________________
consensus AACCGGAAGTCCCATCTTGTTGGTGGCGGGGAAAAGCTCGAATTAGTTCGCCAGTAAGGC
 
. : . : . : . : . : . :
rJMSF014E06+ TCATGTGGCCCCATGGACCACTCCCTGNNGGTTGCATTTGATCCATGTGGCCNNGCAGCC
rJMSF037M01+ TCATGTGGCCCCATGGACCACTCCCTGCTGGTNGCATTCGATCCATGTGGCNTTGCAGCC
rJMSF004L16+ TCATGTGGCCCCATGGACCACTCCCTGCTGGTTGCATTTGATCCATGTGGCCTTGCAGCC
                      ____________________________________________________________
consensus TCATGTGGCCCCATGGACCACTCCCTGCTGGTTGCATTTGATCCATGTGGCCTTGCAGCC
 
. : . : . : . : . : . :
rJMSF014E06+ ACACAACAAAGGGACCCCGTNTTAGCTATGTTTCGGAAGACTCACAAATATTATATTATG
rJMSF037M01+ ACACAACAAAGGGACCCCGTTTTAGCTATGTTTCGGAAGACTCACAAATATTATATTATG
rJMSF028M02+ TGTTTCGGAAGACTCACAANTANTATATTATG
rJMSF004L16+ ACACAACAAAGGGACCCCGTTTTAGCTATGTTTCGGAAGACTCACAAATATTATATTATG
                      ____________________________________________________________
consensus ACACAACAAAGGGACCCCGTTTTAGCTATGTTTCGGAAGACTCACAAATATTATATTATG
 
. : . : . : . : . : . :
rJMSF014E06+ TTTGCTTCTACAATCACTTTGCAGCTCAAAGCGGGTCAGGATGGAACTCCACTAACTACT
rJMSF037M01+ TTNGCTTNTACAATCACTNTGCAGCTCAAA-CGGGTCAGGATGGAACTCCACTAACTACT
rJMSF028M02+ TTTGCTTCTACAATCACNNTGCAGCTCAAA-CGGGTCAGGATGGAACTCCANTAACTACT
rJMSF004L16+ TTTGCTTCTACAATCACTTTGCAGCTCAAA-CGGGTCAGGATGGAACTCCACTAACTACT
                      ____________________________________________________________
consensus TTTGCTTCTACAATCACTTTGCAGCTCAAA-CGGGTCAGGATGGAACTCCACTAACTACT
 
. : . : . : . : . : . :
rJMSF014E06+ CCAGTTT-CTTGGGCATCAACATTCTAAGCCANCACAAGAGCTTCATCT
rJMSF037M01+ CCAGTTT-CTTGGGCATCAACATTCTAAGCCATCACAAGAGCTTCATCT
rJMSF028M02+ CCAGTTTCCTTGGGCATCAACATTCTAAGCCATCACAAGAGCTTCATCT
rJMSF004L16+ CCAGTTT-CTTGGGCATCAACATTCTAAGCCATCACAAGAGCTTCATCTCCTATCCTTAA
                      ____________________________________________________________
consensus CCAGTTT-CTTGGGCATCAACATTCTAAGCCATCACAAGAGCTTCATCTCCTATCCTTAA