Previous Contig 011306:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004K01Sequence439004631 (2)pir|T02644|T026449e-63ABC-type transport protein homolog F12C20.5 - Arabidopsis thaliana>gb:AC005168_1517011306 (3)pir|T02644|T026442e-51ABC-type transport protein homolog F12C20.5 - Arabidopsis thaliana>gb:AC005168_1
JMSF004K03Sequence391007992 (8)440011306 (3)pir|T02644|T026442e-37ABC-type transport protein homolog F12C20.5 - Arabidopsis thaliana>gb:AC005168_1
JMSF009O14Sequence192004631 (2)gb:AY165018_15861562e-22Solanum tuberosum ATP-binding cassette transporter ABC1 (ABC1) gene, partial cds739011306 (3)pir|T02644|T026444e-92ABC-type transport protein homolog F12C20.5 - Arabidopsis thaliana>gb:AC005168_1

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009O14+ TGAAAGATTTGTGTCATATAGA
                      ____________________________________________________________
consensus TGAAAGATTTGTGTCATATAGA
 
. : . : . : . : . : . :
rJMSF009O14+ GAGAGAGCTGCAGGGATGTATTCAGCATTACCATTTGCATTTGCCCAGGTTGTTATTGAG
                      ____________________________________________________________
consensus GAGAGAGCTGCAGGGATGTATTCAGCATTACCATTTGCATTTGCCCAGGTTGTTATTGAG
 
. : . : . : . : . : . :
rJMSF009O14+ TTCCCATACGTGTTTGGGCAAACACTAATCTACAGCGCTATATTCTATTCCCTGGCAGCT
                      ____________________________________________________________
consensus TTCCCATACGTGTTTGGGCAAACACTAATCTACAGCGCTATATTCTATTCCCTGGCAGCT
 
. : . : . : . : . : . :
rJMSF009O14+ TTTGAATGGTCTGCTTCAAAATTTCTTTGGTATATATTCTTTATGTATTTTACAGTTTTG
                      ____________________________________________________________
consensus TTTGAATGGTCTGCTTCAAAATTTCTTTGGTATATATTCTTTATGTATTTTACAGTTTTG
 
. : . : . : . : . : . :
rJMSF004K01+ GAATGATGACCACTGCGGTGACACCCAATCACAATGTGGCTGCC
rJMSF009O14+ TACTTCACCTTTTATGGAATGATGACCACTGCGGTGACACCCAATCACAATGTGGCTGCC
                      ____________________________________________________________
consensus TACTTCACCTTTTATGGAATGATGACCACTGCGGTGACACCCAATCACAATGTGGCTGCC
 
. : . : . : . : . : . :
rJMSF004K01+ ATTATTGCCGCCCCTTTCTATATGCTTTGGAACCTTTTCAGCGGGTTTATGATACCTCAC
rJMSF009O14+ ATTATTGCCGCCCCTTTCTATATGCTTTGGAACCTTTTCAGCGGGTTTATGATACCTCAC
rJMSF004K03+ TCAGCGGGTTTATGATACCTCAC
                      ____________________________________________________________
consensus ATTATTGCCGCCCCTTTCTATATGCTTTGGAACCTTTTCAGCGGGTTTATGATACCTCAC
 
. : . : . : . : . : . :
rJMSF004K01+ AAGAGAATACCGATATGGTGGAGATGGTATTACTGGGCAAATCCGGTCGCCNGGAGTCTT
rJMSF009O14+ AAGAGAATACCGATATGGTGGAGATGGTATTACTGGGCAAATCCGGTCGCCTGGAGTCTT
rJMSF004K03+ AAGAGAATACCGATATGGTGGAGATGGTATTACTGGGCAAATCCGGTCGCCTGGAGTCTT
                      ____________________________________________________________
consensus AAGAGAATACCGATATGGTGGAGATGGTATTACTGGGCAAATCCGGTCGCCTGGAGTCTT
 
. : . : . : . : . : . :
rJMSF004K01+ TACGGGCTTGTTGCTTCCCAGTATAGTGACAGCGAAAGAGCGATTAAACTATCAGATGGG
rJMSF009O14+ TACGGGCTTGTTGCTTCCCAGTATAGTGACAGCGAAAGAGCGATTAAACTATCAGATGGG
rJMSF004K03+ TACGGGCTTGTTGCTTCCCAGTATAGTGACAGCGAAAGAGCGATTAAACTATCAGATGGG
                      ____________________________________________________________
consensus TACGGGCTTGTTGCTTCCCAGTATAGTGACAGCGAAAGAGCGATTAAACTATCAGATGGG
 
. : . : . : . : . : . :
rJMSF004K01+ GTGGAGTCCACTCCTTTGAATCTATTAGTGAAGGTTGTGTTCGGATACAGGCATGATTTC
rJMSF009O14+ GTGGAGTCCACTCCTTTGAATCTATTAGTGAAGGTTGTGTTCGGATACAGGCATGATTTC
rJMSF004K03+ GTGGAGTCCACTCCTTTGAATCTATTAGTGAAGGTTGTGTTCGGATACAGGCATGATTTC
                      ____________________________________________________________
consensus GTGGAGTCCACTCCTTTGAATCTATTAGTGAAGGTTGTGTTCGGATACAGGCATGATTTC
 
. : . : . : . : . : . :
rJMSF004K01+ ATTGGCATNGCTGGTTNTATGGTGGTGGGCTTTTGCATTTTATTTGCAGTTATTTTTGCN
rJMSF009O14+ ATTGGCATTGCTGGTTTTATGGTGGTGGGCTTTTGCATTTTATTTGCAGTTATTTTTGCT
rJMSF004K03+ ATTGGCATTGCTGGTTTTATGGTGGTGGGCTTTTGCATTTTATTTGCAGTTATTTTCGCT
                      ____________________________________________________________
consensus ATTGGCATTGCTGGTTTTATGGTGGTGGGCTTTTGCATTTTATTTGCAGTTATTTTTGCT
 
. : . : . : . : . : . :
rJMSF004K01+ TATGCAATCAAATCGTTCAACTTCCAAAAGAGGTGATATAATGCACCCATGCATGGCGAC
rJMSF009O14+ TATGCAATCAAATCGTTCAACTTCCAAAAGAGGTGATATAATGCACCCATGCATGGCGAC
rJMSF004K03+ TATGCAATCAAATCGTTCAACTTCCAAAAGAGGTGATATAATGCACCCATGCATGGCGAC
                      ____________________________________________________________
consensus TATGCAATCAAATCGTTCAACTTCCAAAAGAGGTGATATAATGCACCCATGCATGGCGAC
 
. : . : . : . : . : . :
rJMSF004K01+ AGATNGTTGATAATAGTGGAATATGAATATGGGGCTGTACAGACAGTTGAGGTGTATGAT
rJMSF009O14+ AGATTGTTGATAATAGTGGAATATGAATATGGGGCTGTACAGACAGTTGA-GTGTATGAT
rJMSF004K03+ AGATTGTTNATAATAGTGGAATATGAATATGGGGCTGTACAGACAGTTGA-GTGTATGAT
                      ____________________________________________________________
consensus AGATTGTTGATAATAGTGGAATATGAATATGGGGCTGTACAGACAGTTGA-GTGTATGAT
 
. : . : . : . : . : . :
rJMSF004K01+ AATTATTNTGGTAAAAAGAGTNTTTAACTCTAGATNCATACT-CCAGTAGTCAT
rJMSF009O14+ AATTATTTTGGTAAAAAGAGTGTTTAACTCTAGATACATACTCCCAGTAGTCAT
rJMSF004K03+ AATTATTTTGGTAAAAAGAGTG-TCAACTCTAGATACATACT-CCAGTAGTCATTCATAT
                      ____________________________________________________________
consensus AATTATTTTGGTAAAAAGAGTGTTTAACTCTAGATACATACT-CCAGTAGTCATTCATAT