Previous Contig 011297:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS091F12Sequence627011297 (2)gb:AY065129_15662832e-20Arabidopsis thaliana unknown protein (At3g08800; F17O14.27) mRNA, complete cds.
JMSF004C03Sequence335004584 (2)gb:AY039964_15604710.041Arabidopsis thaliana unknown protein (At5g10940) mRNA, complete cds.>gb:AY150424366011297 (2)gb:AC084405_17335983e-04Oryza sativa chromosome 3 BAC OSJNBa0044H10 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS091F12- TTTGGATGCCATAGAGTTGCTTGGAAGGTTGTGGGCACGCTTAATAT
                      ____________________________________________________________
consensus TTTGGATGCCATAGAGTTGCTTGGAAGGTTGTGGGCACGCTTAATAT
 
. : . : . : . : . : . :
JMFS091F12- TTCCAAGAAAGTTCTACTCCTACCAAATGGGAGACTGGCGACTATTGTTTGAAAACCTTG
                      ____________________________________________________________
consensus TTCCAAGAAAGTTCTACTCCTACCAAATGGGAGACTGGCGACTATTGTTTGAAAACCTTG
 
. : . : . : . : . : . :
JMFS091F12- ACATGATCCTAAAAGAGATGAGGTATAGGTTCATAGGATTGACAAAAGAGGATGAGTTTC
                      ____________________________________________________________
consensus ACATGATCCTAAAAGAGATGAGGTATAGGTTCATAGGATTGACAAAAGAGGATGAGTTTC
 
. : . : . : . : . : . :
JMFS091F12- ATGTCTTGGAGCTGAAGCTTGTGGCTGATACAGCAAAGCTGTGTAAATTAGAAGCCGGTT
                      ____________________________________________________________
consensus ATGTCTTGGAGCTGAAGCTTGTGGCTGATACAGCAAAGCTGTGTAAATTAGAAGCCGGTT
 
. : . : . : . : . : . :
JMFS091F12- GTCAATATAATACTACGAAGAAATTACATTCCAGTGTTTCCTTGGCGCAGCAACTTCATG
                      ____________________________________________________________
consensus GTCAATATAATACTACGAAGAAATTACATTCCAGTGTTTCCTTGGCGCAGCAACTTCATG
 
. : . : . : . : . : . :
JMFS091F12- AAGAAGGATCAATTTCACTTTCTAGTTTTGTCACAGAACTTCAGAAGGCACTGAATGAGA
                      ____________________________________________________________
consensus AAGAAGGATCAATTTCACTTTCTAGTTTTGTCACAGAACTTCAGAAGGCACTGAATGAGA
 
. : . : . : . : . : . :
JMFS091F12- TCAATATGTCAGGCAGTGCGACCATGGAGAATCCATTTTCGCTTCTGTCCTCACTCAAGC
                      ____________________________________________________________
consensus TCAATATGTCAGGCAGTGCGACCATGGAGAATCCATTTTCGCTTCTGTCCTCACTCAAGC
 
. : . : . : . : . : . :
JMFS091F12- AATTCAAACTGAGACAGTTAGTTTTACCAGGAAAGCTCAAATACATTGAGGCTGAAATGG
                      ____________________________________________________________
consensus AATTCAAACTGAGACAGTTAGTTTTACCAGGAAAGCTCAAATACATTGAGGCTGAAATGG
 
. : . : . : . : . : . :
JMFS091F12- ATGTTCAAGGCACTGACTTTCAAAATCCTCTTCCATTCATTCCGGGGCTACCTGTTGGTA
rJMSF004C03+ TTGGTA
                      ____________________________________________________________
consensus ATGTTCAAGGCACTGACTTTCAAAATCCTCTTCCATTCATTCCGGGGCTACCTGTTGGTA
 
. : . : . : . : . : . :
JMFS091F12- TAT-CCCTTGCAATCACAGTTCATAATGTCTCAGTCGAGAAGAGGCTCTGGATAAAAATG
rJMSF004C03+ TATCCCCTTGCAATCACAGTTCATAATGNNTCAGTCGAGAAGAGGCTCTGGATAAAAATG
                      ____________________________________________________________
consensus TATCCCCTTGCAATCACAGTTCATAATGTCTCAGTCGAGAAGAGGCTCTGGATAAAAATG
 
. : . : . : . : . : . :
JMFS091F12- AGTCTAGAAGAGAAGATGACTCAGTTTGCATTCT
rJMSF004C03+ AGTCTAGAAGNGAAGATGACTCAGTNTGCATTCTNNGATCTGCGTGAGCTCGGAGGAGAT
                      ____________________________________________________________
consensus AGTCTAGAAGAGAAGATGACTCAGTTTGCATTCTNNGATCTGCGTGAGCTCGGAGGAGAT
 
. : . : . : . : . : . :
rJMSF004C03+ GATGAAGTCAGAAAGTTCACAATTGTCGCACCATTTTACANAACCCCTAGAGACTAGGTG
                      ____________________________________________________________
consensus GATGAAGTCAGAAAGTTCACAATTGTCGCACCATTTTACANAACCCCTAGAGACTAGGTG
 
. : . : . : . : . : . :
rJMSF004C03+ TTTCTCATTGAGGGTCTTGTATTGTTATAGNATGTTCATCAGACTGTTCCCAGATGCCCA
                      ____________________________________________________________
consensus TTTCTCATTGAGGGTCTTGTATTGTTATAGNATGTTCATCAGACTGTTCCCAGATGCCCA
 
. : . : . : . : . : . :
rJMSF004C03+ GGAANTGTGGTGGTCCGAAACATGATATTGCTTATATACGTGAAGAGAAAGAAGTGTTTT
                      ____________________________________________________________
consensus GGAANTGTGGTGGTCCGAAACATGATATTGCTTATATACGTGAAGAGAAAGAAGTGTTTT
 
. : . : . : . : . : . :
rJMSF004C03+ TCTCCATGGTTGTAAAATAGTTGATGCAGTTAGATGATTGTTGTATACACTTAATGGTTT
                      ____________________________________________________________
consensus TCTCCATGGTTGTAAAATAGTTGATGCAGTTAGATGATTGTTGTATACACTTAATGGTTT