Previous Contig 011282:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005L05Sequence146011282 (2)
JMSF003M14Sequence362018337767011282 (2)pir|T51951|T519519e-46gamma-adaptin 1 [imported] - Arabidopsis thaliana>gb:AF061286_1765209 Arabidopsi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF003M14+ AATATCCATCAATTATGCATTTGAGAGTAGTTCTATAAAATTAATGTT
                      ____________________________________________________________
consensus AATATCCATCAATTATGCATTTGAGAGTAGTTCTATAAAATTAATGTT
 
. : . : . : . : . : . :
rJMSF003M14+ CAACTTCTCAAAGCAGCCCGGAAATCCACAAACAACAGTTGTCGAGGCTAATTTTACAAA
                      ____________________________________________________________
consensus CAACTTCTCAAAGCAGCCCGGAAATCCACAAACAACAGTTGTCGAGGCTAATTTTACAAA
 
. : . : . : . : . : . :
rJMSF003M14+ CAAATCAGAAAATGTATTCACAGACTTCATCTTCCAGGCTGCTGTCCCAAAGTTTCTTCA
                      ____________________________________________________________
consensus CAAATCAGAAAATGTATTCACAGACTTCATCTTCCAGGCTGCTGTCCCAAAGTTTCTTCA
 
. : . : . : . : . : . :
rJMSF003M14+ ACTACATTTGGATCCAGCCAGCAGCAACACGCTTCCTGCAACCGGCAATGGATCAATTAC
                      ____________________________________________________________
consensus ACTACATTTGGATCCAGCCAGCAGCAACACGCTTCCTGCAACCGGCAATGGATCAATTAC
 
. : . : . : . : . : . :
rJMSF003M14+ ACAGAAATTAAGGGTCATAAACAGCCAACATGGCAAGAAATCCCTTGTCATGCGCTTAAG
                      ____________________________________________________________
consensus ACAGAAATTAAGGGTCATAAACAGCCAACATGGCAAGAAATCCCTTGTCATGCGCTTAAG
 
. : . : . : . : . : . :
rJMSF003M14+ GATAGGCTATAAGATGAATGGCAAAGACGTTTTGGAGGAAGGACAAATCAACAACTTCCC
                      ____________________________________________________________
consensus GATAGGCTATAAGATGAATGGCAAAGACGTTTTGGAGGAAGGACAAATCAACAACTTCCC
 
. : . : . : . : . : . :
rJMSF003M14+ ACGTGGCTTGTAAGGTTCAACGGCCGCAGAAGAGGGAAATTAGCGAGATTTTATTATTGT
                      ____________________________________________________________
consensus ACGTGGCTTGTAAGGTTCAACGGCCGCAGAAGAGGGAAATTAGCGAGATTTTATTATTGT
 
. : . : . : . : . : . :
rJMSF003M14+ TATTATTAATATTATTTCATTGCGGAGAAGCAAATGTGGTTGCCGTTTTGTATTTTTTCA
                      ____________________________________________________________
consensus TATTATTAATATTATTTCATTGCGGAGAAGCAAATGTGGTTGCCGTTTTGTATTTTTTCA
 
. : . : . : . : . : . :
rJMSF003M14+ GTGCAATTTATTGAACTTGTTTTGCACAATGCGGCTTTGTGGTGGTTGGGAGAGTGAGTG
                      ____________________________________________________________
consensus GTGCAATTTATTGAACTTGTTTTGCACAATGCGGCTTTGTGGTGGTTGGGAGAGTGAGTG
 
. : . : . : . : . : . :
rJMFF005L05+ GAAAAGTTGCCNAATGTAGATTAT
rJMSF003M14+ TGTTTCACCTGGGAATTATGGGGTTTCTATCCCCTTGAAAAGTTGCCAAATGTAGATTAT
                      ____________________________________________________________
consensus TGTTTCACCTGGGAATTATGGGGTTTCTATCCCCTTGAAAAGTTGCCAAATGTAGATTAT
 
. : . : . : . : . : . :
rJMFF005L05+ AAGCAGATCAATTCATGTATGGCATCGTGGGAGAGTGAAGCTTNGANTAGGAGGAGGATA
rJMSF003M14+ AAGCAGATCAATTCATGTATGGCATTGTGGGAGAGTGAAGCTTTGAGTAGGAGGAGGATA
                      ____________________________________________________________
consensus AAGCAGATCAATTCATGTATGGCATTGTGGGAGAGTGAAGCTTTGAGTAGGAGGAGGATA
 
. : . : . : . : . : . :
rJMFF005L05+ AGGNTTNTATNTATACTACAGAAGANNTAGCAAGGAAATCAATCAAATCATGTGTCANCA
rJMSF003M14+ AGGATTTTATATATACTACAGAAGACTTAG-AAGGAAATCAATCAAATCATGTGTCAGCA
                      ____________________________________________________________
consensus AGGATTTTATATATACTACAGAAGACTTAGCAAGGAAATCAATCAAATCATGTGTCAGCA
 
. : . : . : . : . : . :
rJMFF005L05+ GG
rJMSF003M14+ GGTTCTTTGTTAAACAATTTTGGGTGGCTGTAATCTTTTCCAATTGCCAGCTTGGAGAGA
                      ____________________________________________________________
consensus GGTTCTTTGTTAAACAATTTTGGGTGGCTGTAATCTTTTCCAATTGCCAGCTTGGAGAGA