Previous Contig 011279:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN025I05Sequence540011279 (2)gb:PTR306825_17027196e-26Populus tremula x Populus tremuloides mRNA for aux/IAA protein (IAA2 gene).
JMSF003L21Sequence260003381 (2)738011279 (2)gb:AY090553_15741591e-61Zinnia elegans auxin-regulated protein (IAA8) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN025I05+ GAGAACTAGTCTCGAGXXXXXXXXXXXXXXXXXXGACAGTAATGGATGGATGAAGATTGG
                      ____________________________________________________________
consensus GAGAACTAGTCTCGAGNNNNNNNNNNNNNNNNNNGACAGTAATGGATGGATGAAGATTGG
 
. : . : . : . : . : . :
JMFN025I05+ AGTTAAGAATCAAACTTCATACAATCTTGGCAGTCTAGTACAAAGCAACTATTTAATTAA
rJMSF003L21- AAGCAACTATTTAATTAA
                      ____________________________________________________________
consensus AGTTAAGAATCAAACTTCATACAATCTTGGCAGTCTAGTACAAAGCAACTATTTAATTAA
 
. : . : . : . : . : . :
JMFN025I05+ GTTTGCATTAACAACTTGAGTTGAAAGTTACATCTTCAGAGTACACAACTATGTTACTGC
rJMSF003L21- GTTTGCATTAACAACTTGAGTTGAAAGTTACATCTTCAGAGTACACAACTATGTTACTGC
                      ____________________________________________________________
consensus GTTTGCATTAACAACTTGAGTTGAAAGTTACATCTTCAGAGTACACAACTATGTTACTGC
 
. : . : . : . : . : . :
JMFN025I05+ TATATCTTCTTGATCACAGTAGTTGTTCCATTCTTTGGATGTTACACCTAATCAAACTAC
rJMSF003L21- TATATCTTCTTGATCACAGTAGTTGTTCCATTCTTTGGATGTTACACCTAATCAAACCAC
                      ____________________________________________________________
consensus TATATCTTCTTGATCACAGTAGTTGTTCCATTCTTTGGATGTTACACCTAATCAAACTAC
 
. : . : . : . : . : . :
JMFN025I05+ AAAACTAGAAGGAATATCCTATACTGTGCACAGTATCTCTGGATTCTCCTTGCAGGAGAT
rJMSF003L21- AAAACTAGAAGGAATATCCTATACTGTGCACAGTATCTCTGGATTCTCCTTGCAGGAGAT
                      ____________________________________________________________
consensus AAAACTAGAAGGAATATCCTATACTGTGCACAGTATCTCTGGATTCTCCTTGCAGGAGAT
 
. : . : . : . : . : . :
JMFN025I05+ TCCCTGCATCACTTCTCGATCTTGAATTTCTGTGCAGCCCTCGGTGCTAGACCAATGGCA
rJMSF003L21- TCCCTGCATCACTTCTCGATCTTGAATTTCTGTGCAGCCCTCGGTGCTAGACCAATGGCA
                      ____________________________________________________________
consensus TCCCTGCATCACTTCTCGATCTTGAATTTCTGTGCAGCCCTCGGTGCTAGACCAATGGCA
 
. : . : . : . : . : . :
JMFN025I05+ TCTGCACTTTTCATGATTCGTAATTTCTTGCATGACTCGGTGAACATCTCCCATGGGATA
rJMSF003L21- TCTGCACTTTTCATGATTCGTAATTTCTTGCATGACTCGGTGAACATCTCCCATGGGACA
                      ____________________________________________________________
consensus TCTGCACTTTTCATGATTCGTAATTTCTTGCATGACTCGGTGAACATCTCCCATGGGATA
 
. : . : . : . : . : . :
JMFN025I05+ TCACCAACAAGCATCCAGTCACCATCCTTGTCTTCGTAAGTTAGCACATACTCTGACCCA
rJMSF003L21- TCACCAACAAGCATCCAGTCACCATCCTTGTCTTCGTAAGTTAGCACATACTCTGACCCA
                      ____________________________________________________________
consensus TCACCAACAAGCATCCAGTCACCATCCTTGTCTTCGTAAGTTAGCACATACTCTGACCCA
 
. : . : . : . : . : . :
JMFN025I05+ CTTGTGAGATCAATTAAGTTGGTTTCATCGAGCTTCTTTCGTCCAGGGAATCCATCAGAA
rJMSF003L21- CTTGTGAGATCAATTAAGTTGGTTTCATCGAGCTTCTTTCGTCCAGGGAATCCATCAGAA
                      ____________________________________________________________
consensus CTTGTGAGATCAATTAAGTTGGTTTCATCGAGCTTCTTTCGTCCAGGGAATCCATCAGAA
 
. : . : . : . : . : . :
rJMSF003L21- CTGCATTGTCCTGTTTTGTAAACGAGGGGGAGAGTCATACCAACTGTGAAACACCCGAAC
                      ____________________________________________________________
consensus CTGCATTGTCCTGTTTTGTAAACGAGGGGGAGAGTCATACCAACTGTGAAACACCCGAAC
 
. : . : . : . : . : . :
rJMSF003L21- ATCTTCTGGAGAGCTGATGAGAGCTCCGAATAATTAGCGTAGCTTTTAAGATCTACCTTT
                      ____________________________________________________________
consensus ATCTTCTGGAGAGCTGATGAGAGCTCCGAATAATTAGCGTAGCTTTTAAGATCTACCTTT
 
. : . : . : . : . : . :
rJMSF003L21- CTTAGATATGGAGCTCCTTCCAAGCTAACTTTGACAAAAATGCAACCAGGTCCCGGTTTC
                      ____________________________________________________________
consensus CTTAGATATGGAGCTCCTTCCAAGCTAACTTTGACAAAAATGCAACCAGGTCCCGGTTTC
 
. : . : . : . : . : . :
rJMSF003L21- GCCTCAACGTCGTTGTTTTTCTTTACGTTGGAGGCAAGGGTGTTCTTGCGAAATGATCTA
                      ____________________________________________________________
consensus GCCTCAACGTCGTTGTTTTTCTTTACGTTGGAGGCAAGGGTGTTCTTGCGAAATGATCTA
 
. : . : . : . : . : . :
rJMSF003L21- ACAGGTGGCCATCCAACTACTTGCGCCTTTGGGGCAGGAGCACCAACATTCTCATTTATA
                      ____________________________________________________________
consensus ACAGGTGGCCATCCAACTACTTGCGCCTTTGGGGCAGGAGCACCAACATTCTCATTTATA