Previous Contig 011270:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019B10Sequence508011270 (3)pir|T07964|T079644e-32(S)-N-methylcoclaurine 3'-hydroxylase (EC 1.1.3.-) - California poppy>gb:AF01480751009099 (3)gb:AB015762_15127294e-59Nicotiana tabacum CYP82E1 mRNA for cytochrome P450, complete cds.>gb:AF368381_17
JMFF039I04Sequence505011270 (3)pir|T07964|T079641e-30(S)-N-methylcoclaurine 3'-hydroxylase (EC 1.1.3.-) - California poppy>gb:AF01480756009099 (3)gb:AB015762_15127292e-58Nicotiana tabacum CYP82E1 mRNA for cytochrome P450, complete cds.>gb:AF368381_17
JMSF003J11Sequence370018323pir|T05942|T059422e-09cytochrome P450 82C1 - soybean>gb:AF022461_1761996 Glycine max cytochrome P450 m643011270 (3)pir|T07964|T079642e-20(S)-N-methylcoclaurine 3'-hydroxylase (EC 1.1.3.-) - California poppy>gb:AF01480

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF019B10+ GACATCCACACAGGNTTCAGTTTCTCCAGTGTGTTGTTTGAGAGCAAT
                      ____________________________________________________________
consensus GACATCCACACAGGNTTCAGTTTCTCCAGTGTGTTGTTTGAGAGCAAT
 
. : . : . : . : . : . :
JMFF019B10+ TCCACCACCACTAGCTTGCGCATGCGGCGCCAGTATGGACAGTGCAGACTGAACGGCAAC
JMFF039I04+ ACCACTAGCTTGCGCATGCGGCGCCAGTATGGACAGTGCAGACTGAACGGCAAC
                      ____________________________________________________________
consensus TCCACCACCACTAGCTTGCGCATGCGGCGCCAGTATGGACAGTGCAGACTGAACGGCAAC
 
. : . : . : . : . : . :
JMFF019B10+ ACTGCATAGTCGTACCCCAAATACCTCCCTGCACAACTAGGCGGGCGATCAGCGAGGAGC
JMFF039I04+ ACTGCATAGTCGTACCCCAAATACCTCCCTGCACAACTAGGCGGGCGATCAGCGAGGAGC
rJMSF003J11+ CCTGCACAACTAGGCGGGCGATCAGCGAGGAGC
                      ____________________________________________________________
consensus ACTGCATAGTCGTACCCCAAATACCTCCCTGCACAACTAGGCGGGCGATCAGCGAGGAGC
 
. : . : . : . : . : . :
JMFF019B10+ TTGTCGTTGGTAGAGAAGCAATCTCTGGCGGTTTCCCAGCTGNTAATGACANCCGATGGN
JMFF039I04+ TTGTCGTTGGTAGAGAAGCAATCTCTGGCGGTTTCCCAGCTGCTAATGACAACCGATGGC
rJMSF003J11+ TTGTCGTTGGTAGAGAAGCAATCTCTGGCGGNTTCCCAGCTGCTAATGACAACCGANGGC
                      ____________________________________________________________
consensus TTGTCGTTGGTAGAGAAGCAATCTCTGGCGGTTTCCCAGCTGCTAATGACAACCGATGGC
 
. : . : . : . : . : . :
JMFF019B10+ TGCATTCCGATCCGGACGGTGAATATAGGGCCGTATTTATCCGCCAGCGCTCCCAAAGTC
JMFF039I04+ TGCATTCCGATCCGGACGGTGAATATAGGGCCGTATTTATCCGCCAGCGCTCCCAAAGTC
rJMSF003J11+ TGCATTCCGATCCGGACGGTGAATATAGGGCCGTATTTATCCGCCAGCGCTCCCAAAGTC
                      ____________________________________________________________
consensus TGCATTCCGATCCGGACGGTGAATATAGGGCCGTATTTATCCGCCAGCGCTCCCAAAGTC
 
. : . : . : . : . : . :
JMFF019B10+ CGAACCAGTGGTTCCTTGCCGGAGGTGAGCTGCCGGAGGTGGCCGATCNCCGGCCATGCG
JMFF039I04+ CGAACCAGTGGTTCCTTGCCGGAGGTGAGCTGCCGGAGGTGGCCGATCACCGGCCATGCG
rJMSF003J11+ CGAACCAGTGGTTCCTTGCCGGAGGTGAGCTGCCGGNGGTGGCCGATCACCGNCCATGCG
                      ____________________________________________________________
consensus CGAACCAGTGGTTCCTTGCCGGAGGTGAGCTGCCGGAGGTGGCCGATCACCGGCCATGCG
 
. : . : . : . : . : . :
JMFF019B10+ CCGGGGACTACCGGAGGTTTTGAATTGCTATTACTTTTTCTTCCTCGCCGTGAAGTGTAG
JMFF039I04+ CCGGGGACTACCGGAGGTTTTGAATTGCTATTACTTTTTCTTCCTCGCCGTGAAGTGTAG
rJMSF003J11+ CCGGGGACTACCGGAGGTTTTGAATTGCTATTACTTTTTCTTCCTCGCCGTGAAGTGTAG
                      ____________________________________________________________
consensus CCGGGGACTACCGGAGGTTTTGAATTGCTATTACTTTTTCTTCCTCGCCGTGAAGTGTAG
 
. : . : . : . : . : . :
JMFF019B10+ AGTAACGCGAAGATGAATATCCCTGCTATGGNTAAGGAATTGGAGACAAGAAGCTCCATT
JMFF039I04+ AGTAACGCGAAGATGAATATCCCTGCTATGGCTAAGGAATTGGAGACAAGAAGCTCCATT
rJMSF003J11+ AGTNACGCGAAGATGAATATCCCTGCTACGGNTAAGGANTTGGAGACAAGAAGCTCCATT
                      ____________________________________________________________
consensus AGTAACGCGAAGATGAATATCCCTGCTATGGCTAAGGAATTGGAGACAAGAAGCTCCATT
 
. : . : . : . : . : . :
JMFF019B10+ ATTGGTTGGTAATTAATTTCTTTGAGTTCGATTC
JMFF039I04+ ATTGGTTGGTAATTAATTTCTTTGAGTTCGATTCCTCAATTGATCTGCTGGGATTGAAGC
rJMSF003J11+ ATTGGTTGGTAATTAATTTCTTTGAGTTCGATTCCTCAATTGATCTGCTGGGATTGAAGC
                      ____________________________________________________________
consensus ATTGGTTGGTAATTAATTTCTTTGAGTTCGATTCCTCAATTGATCTGCTGGGATTGAAGC
 
. : . : . : . : . : . :
JMFF039I04+ TGCAGGTAGATATTGCGTTAATAGGGAAA
rJMSF003J11+ TGCAGGTAGATATTGCGTTAATAGGGAAATAATGATNATGTTGAAGAGTAGTACCATTAT
                      ____________________________________________________________
consensus TGCAGGTAGATATTGCGTTAATAGGGAAATAATGATNATGTTGAAGAGTAGTACCATTAT
 
. : . : . : . : . : . :
rJMSF003J11+ TGTGGATAGTGTTGGTCAAATAACAAAAATTGATAGTAAAATATTTTTTATATAAAAAAA
                      ____________________________________________________________
consensus TGTGGATAGTGTTGGTCAAATAACAAAAATTGATAGTAAAATATTTTTTATATAAAAAAA
 
. : . : . : . : . : . :
rJMSF003J11+ ATAATAATAATACTCCTTATTAAANATTTTATCTTTCTCAGATACAAAAANTATGCTTTA
                      ____________________________________________________________
consensus ATAATAATAATACTCCTTATTAAANATTTTATCTTTCTCAGATACAAAAANTATGCTTTA