Previous Contig 011266:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003H19Sequence397011266 (4)gb:AY063101_15656769e-07Arabidopsis thaliana unknown protein (At1g44920) mRNA, complete cds.>gb:T12C22_1679011266 (4)gb:AY063101_15656764e-30Arabidopsis thaliana unknown protein (At1g44920) mRNA, complete cds.>gb:T12C22_1
JMSF026K16Sequence701011266 (4)gb:AY063101_15656761e-45Arabidopsis thaliana unknown protein (At1g44920) mRNA, complete cds.>gb:T12C22_1752011266 (4)gb:AY063101_15656765e-65Arabidopsis thaliana unknown protein (At1g44920) mRNA, complete cds.>gb:T12C22_1

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF003H19- GGACCGGTCGACCGCTATCATCATCCATTGATTCATT
JMSF026K16- CCGCTATCATCATCCATTGATTCATT
                      ____________________________________________________________
consensus GGACCGGTCGACCGCTATCATCATCCATTGATTCATT
 
. : . : . : . : . : . :
JMSF003H19- GGAGAC-AAGAGCGATGAATCTGCTGCTACCAGGCGGAGGCGGAGGACCCTCACTCTCCT
JMSF026K16- GGAGACGAAGAGCGATGAATCTGCTGCTACCAGGCGGAGGCGGAGGACCCTCACTCTCCT
                      ____________________________________________________________
consensus GGAGACGAAGAGCGATGAATCTGCTGCTACCAGGCGGAGGCGGAGGACCCTCACTCTCCT
 
. : . : . : . : . : . :
JMSF003H19- CTTCGCACCTATGCTCCCTCAAATTCATTCACCCTCTCCCCCCTCTTTTCTCCTCCATTT
JMSF026K16- CTTCGCACCTATGCTCCCTCAAATTCATTCACCCTCTCCCCCCTCTTTTCTCCTCCATTT
                      ____________________________________________________________
consensus CTTCGCACCTATGCTCCCTCAAATTCATTCACCCTCTCCCCCCTCTTTTCTCCTCCATTT
 
. : . : . : . : . : . :
JMSF003H19- CTCACGCGCCCAAGATTCGCTGCAAGCCCATCACTCTCGCCAGAGCCGACACCGGAGCTT
JMSF026K16- CTCACGCGCCCAAGATTCGCTGCAAGCCCATCACTCTCGCCAGAGCCGACACCGGAGCTT
rJMSF026K16+ CTCACGCGCCCAAGATTCGCTGCAAGCCCATCACTCTCGCCAGAGCCGACACCGGAGCTT
                      ____________________________________________________________
consensus CTCACGCGCCCAAGATTCGCTGCAAGCCCATCACTCTCGCCAGAGCCGACACCGGAGCTT
 
. : . : . : . : . : . :
JMSF003H19- CCCGCCCCACCGCGACCACCGCCGCACCCAGTTCAACTCCTCTGAACGCCAGAGCCGATG
JMSF026K16- CCCGCCCCACCGCGACCACCGCCGCACCCAGTTCAACTCCTCTGAACGCCAGAGCCGATG
rJMSF026K16+ CCCGCCCCACCGCGACCACCGCCGCACCCAGTTCAACTCCTCTGAACGCCAGAGCCGATG
rJMSF003H19+ CCTCTGAACGCCAGAGCCGATG
                      ____________________________________________________________
consensus CCCGCCCCACCGCGACCACCGCCGCACCCAGTTCAACTCCTCTGAACGCCAGAGCCGATG
 
. : . : . : . : . : . :
JMSF003H19- AGGACGCGATATCTTTGGTCACCCAAGACGAGGTTCCTCTTGAAGGTGTTATCCAGTTCG
JMSF026K16- AGGACGCGATATCTTTGGTCACCCAAGACGAGGTTCCTCTTGAAGGTGTTATCCAGTTCG
rJMSF026K16+ AGGACGCGATATCTTTGGTCACCCAAGACGAGGTTCCTCTTGAAGGTGTTATCCAGTTCG
rJMSF003H19+ AGGACGCGATATCTTTGGTCACCCAAGACGAGGTTCCTCTTGAAGGTGTTATCCAGTTCG
                      ____________________________________________________________
consensus AGGACGCGATATCTTTGGTCACCCAAGACGAGGTTCCTCTTGAAGGTGTTATCCAGTTCG
 
. : . : . : . : . : . :
JMSF003H19- AGAAGCCCGATTCTTCTTCCAAGATTTCCAAATGGGGCAAAGTGGCATTGCTAGCTGGTG
JMSF026K16- AGAAGCCCGATTCTTCTTCCAAGATTTCCAAATGGGGCAAAGTGGCATTGCTAGCTGGTG
rJMSF026K16+ AGAAGCCCGATTCTTCTTCCAAGATTTCCAAATGGGGCAAAGTGGCATTGCTAGCTGGTG
rJMSF003H19+ AGAAGCCCGATTCTTCTTCCAAGATTTCCAAATGGGGCAAAGTGGCATTGCTAGCTGGTG
                      ____________________________________________________________
consensus AGAAGCCCGATTCTTCTTCCAAGATTTCCAAATGGGGCAAAGTGGCATTGCTAGCTGGTG
 
. : . : . : . : . : . :
JMSF003H19- G
JMSF026K16- GGGATGTCGCCGCTTTGCTCTTGTTCTCCGCAGTTGGAAGATTCAGCCATGGTTTTCCTG
rJMSF026K16+ GGGATGTCGCCGCTTTGCTCTTGTTCTCCGCAGTTGGAAGATTCAGCCATGGTTTTCCTG
rJMSF003H19+ GGGATGTCGCCGCTTTGCTCTTGTTCTCCGCAGTTGGAAGATTCAGCCATGGTTTTCCTG
                      ____________________________________________________________
consensus GGGATGTCGCCGCTTTGCTCTTGTTCTCCGCAGTTGGAAGATTCAGCCATGGTTTTCCTG
 
. : . : . : . : . : . :
JMSF026K16- TTTTTGAGCCTGAGACTTTGCGAACAGCTGACCCCTTCATTGCTGGGTGGTTTTTGAGTG
rJMSF026K16+ TTTTTGAGCCTGAGACTTTGCGAACAGCTGACCCCTTCATTGCTGGGTGGTTTTTGAGTG
rJMSF003H19+ TTTTTGAGCCTGAGACTTTGCGAACAGCTGACCCCTTCATTGCTGGGTGGTTTTTGAGTG
                      ____________________________________________________________
consensus TTTTTGAGCCTGAGACTTTGCGAACAGCTGACCCCTTCATTGCTGGGTGGTTTTTGAGTG
 
. : . : . : . : . : . :
JMSF026K16- CATATTTTCTCGGGGGTTATGGAGAGGATGGTCGAGGTATGAATGGCCTGTTTAAAGCAT
rJMSF026K16+ CATATTTTCTCGGGGGTTATGGAGAGGATGGTCGAGGTATGAATGGCCTGTTTAAAGCAT
rJMSF003H19+ CATATTTTCTCGGGGGTTATGGAGAGGATGGTCGAGGTATGAATGGCCTGTTTAAAGCAT
                      ____________________________________________________________
consensus CATATTTTCTCGGGGGTTATGGAGAGGATGGTCGAGGTATGAATGGCCTGTTTAAAGCAT
 
. : . : . : . : . : . :
JMSF026K16- TTATTGCTGCAACAAAGTCTTGGGCTTTAGGTATCCCGTTGGGTTTAGCCATAAGGGCTG
rJMSF026K16+ TTATTGCTGCAACAAAGTCTTGGGCTTTAGGTATCCCGTTGGGTTTAGCCATAAGGGCTG
rJMSF003H19+ TTATTGCTGCA--AAAGTCTTGGGCTTTAGGTATCCCGTTGGGTTTAGCCATAAGGGCTG
                      ____________________________________________________________
consensus TTATTGCTGCAACAAAGTCTTGGGCTTTAGGTATCCCGTTGGGTTTAGCCATAAGGGCTG
 
. : . : . : . : . : . :
JMSF026K16- CAACAGTGGGTCACGTACCGCCAGTCAACTTTGTAACAGTCACCATGGGGAGCACCGCTA
rJMSF026K16+ CAACAGTGGGTCACGTACCGCCAGTCAACTTTGTAACAGTCACCATGGGGAGCACCGCTA
rJMSF003H19+ CAACAGTGGGTCACGTACCGCCAGTCAACTTTGTAACAGTCACCATGGGGAGCACCGCTA
                      ____________________________________________________________
consensus CAACAGTGGGTCACGTACCGCCAGTCAACTTTGTAACAGTCACCATGGGGAGCACCGCTA
 
. : . : . : . : . : . :
JMSF026K16- TATTACTTATTG
rJMSF026K16+ TATTACTTATTGGATGGAGGACGTTGTTGTTTAGCGTTCTTCCTGATGATCGGAAGAAGA
rJMSF003H19+ TATTACTTATTGGATGGAGGACGTTGTTGTTTAGCGTTCTTCCTGATGATCGGAAGAAGA
                      ____________________________________________________________
consensus TATTACTTATTGGATGGAGGACGTTGTTGTTTAGCGTTCTTCCTGATGATCGGAAGAAGA
 
. : . : . : . : . : . :
rJMSF026K16+ AGAATGATGTATATAAGCGCGGTAGTCCATTTGAGCTTTTCGAGTTGCTGACATCTTTGG
rJMSF003H19+ AGAATGATGTATATAAGCGCGGTAGTCCATTTGAGCTTTTCGAGTTGCTGACATCTTTGG
                      ____________________________________________________________
consensus AGAATGATGTATATAAGCGCGGTAGTCCATTTGAGCTTTTCGAGTTGCTGACATCTTTGG
 
. : . : . : . : . : . :
rJMSF026K16+ TTAGAAGATGGTGAATGATGGGTAGCAACAACATTGAGCTTCCTTGTCTGTAGTAATTCT
rJMSF003H19+ TTAGAAGATGGTGAATGATGGGTAGCAACAACATTGAGCTTTCTTGTCTGTAGTAATTCT
                      ____________________________________________________________
consensus TTAGAAGATGGTGAATGATGGGTAGCAACAACATTGAGCTTTCTTGTCTGTAGTAATTCT
 
. : . : . : . : . : . :
rJMSF026K16+ CTGAGAAGGCAATTTTCCAAGTTGTAC
rJMSF003H19+ CTGAGAAGGCAATTTT-CAAGTTGTACATGTTTTCTGTGATCAAGAACCAAAGTGCAATA
                      ____________________________________________________________
consensus CTGAGAAGGCAATTTTCCAAGTTGTACATGTTTTCTGTGATCAAGAACCAAAGTGCAATA