Previous Contig 011265:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003G24Sequence296004511 (3)754011265 (2)gb:AY084553_15696422e-36Arabidopsis thaliana clone 111522 mRNA, complete sequence.
JMSF037J06Sequence627004511 (3)gb:AY084553_15696422e-20Arabidopsis thaliana clone 111522 mRNA, complete sequence.770011265 (2)gb:AY084553_15696422e-36Arabidopsis thaliana clone 111522 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF037J06+ TGCTCGCA
                      ____________________________________________________________
consensus TGCTCGCA
 
. : . : . : . : . : . :
rJMSF037J06+ GTGGGCTATTCTATGGGAATGCTTTCACTAACATGTGGAGTGAGTCTCAGTCATCTTGTT
rJMSF003G24+ ACTAACATGTGGAGTGAGTCTCAGTCATCTTGTT
                      ____________________________________________________________
consensus GTGGGCTATTCTATGGGAATGCTTTCACTAACATGTGGAGTGAGTCTCAGTCATCTTGTT
 
. : . : . : . : . : . :
rJMSF037J06+ TGTCATTACTTCCCGTACGTGTTAGAGGGTCTGCATCTGTAACCGTCTACCGGACTAAAA
rJMSF003G24+ TGTCATTACTTCCCGTACGTGTTAGAGGGTCTGCATCTGTAACCGTCTACCGGACTAAAA
                      ____________________________________________________________
consensus TGTCATTACTTCCCGTACGTGTTAGAGGGTCTGCATCTGTAACCGTCTACCGGACTAAAA
 
. : . : . : . : . : . :
rJMSF037J06+ ACCCCGATGCAAGTATAAGAACTTCTTTTCTATCTCGAGGAATTGTCAAGTTGTTGCCAG
rJMSF003G24+ ACCCCGATGCAAGTATAAGAACTTCTTTTCTATCTCGAGGAATTGTCAAGTTGTTGCCAG
                      ____________________________________________________________
consensus ACCCCGATGCAAGTATAAGAACTTCTTTTCTATCTCGAGGAATTGTCAAGTTGTTGCCAG
 
. : . : . : . : . : . :
rJMSF037J06+ AAAAGTGTTATATGGGAAACGTGTATAGAAAACAGAGTTCTGTGTTTGATTCTCTGAGCC
rJMSF003G24+ AAAAGTGTTATATGGGAAACGTGTATAGAAAACAGAGTTCTGTGTTTGATTCTCTGAGCC
                      ____________________________________________________________
consensus AAAAGTGTTATATGGGAAACGTGTATAGAAAACAGAGTTCTGTGTTTGATTCTCTGAGCC
 
. : . : . : . : . : . :
rJMSF037J06+ AGAGGGTGACTTCACTGGAAAATGTTTTGAAGAGCTTTCTGGGTGGCAGAACCAACAGAA
rJMSF003G24+ AGAGGGTGACTTCACTGGAAAATGTTTTGAAGAGCTTTCTGGGTGGCAGAACCAACAGAA
                      ____________________________________________________________
consensus AGAGGGTGACTTCACTGGAAAATGTTTTGAAGAGCTTTCTGGGTGGCAGAACCAACAGAA
 
. : . : . : . : . : . :
rJMSF037J06+ ATACCGGATTGGGTCTAAAAATAAGAATCAAACCGTCATATATCTTCCGTTTCCAGATTG
rJMSF003G24+ ATACCGGATTGGGTCTAAAAATAAGAATCAAACCGTCATATATCTTCCGTTTCCAGATTG
                      ____________________________________________________________
consensus ATACCGGATTGGGTCTAAAAATAAGAATCAAACCGTCATATATCTTCCGTTTCCAGATTG
 
. : . : . : . : . : . :
rJMSF037J06+ AATTAGAACGAAATATCCGTAGCAATGATACCTACTGGAGTACATTGGGCGAGTGGAGAA
rJMSF003G24+ AATTAGAACGAAATATCCGTAGCAATGATACCTACTGGAGTACATTGGGCGAGTGGAGAA
                      ____________________________________________________________
consensus AATTAGAACGAAATATCCGTAGCAATGATACCTACTGGAGTACATTGGGCGAGTGGAGAA
 
. : . : . : . : . : . :
rJMSF037J06+ CAAGGCCAGCTGCTGAACGTGTTTGGTTCGAGGTGGTGGCAGGAATTGGGTCCGGGTTTA
rJMSF003G24+ CAAGGCCAGCTGCTGAACGTGTTTGGTTCGAGGTGGTGGCAGGAATTGGGTCCGGGTTTA
                      ____________________________________________________________
consensus CAAGGCCAGCTGCTGAACGTGTTTGGTTCGAGGTGGTGGCAGGAATTGGGTCCGGGTTTA
 
. : . : . : . : . : . :
rJMSF037J06+ TGAAGCCATTCACGATAAGGAAAGTCCGACCATTTATTGAAGTAGATTCACTATCGTGGA
rJMSF003G24+ TGAAGCCATTCACGATAAGGAAAGTCCGACCATTTATTGAAGTAGATTCACTATCGTGGA
                      ____________________________________________________________
consensus TGAAGCCATTCACGATAAGGAAAGTCCGACCATTTATTGAAGTAGATTCACTATCGTGGA
 
. : . : . : . : . : . :
rJMSF037J06+ GCAGTTTAATGTCAAACATTTCCTTCACAAAGTTTCCGTCTTTCCTCGTCCCTCCAGAGC
rJMSF003G24+ GCAGTTTAATGTCAAACATTTCCTTCACAAAGTTTCCGTCTTTCCTCGTCCCTCCAGAGC
                      ____________________________________________________________
consensus GCAGTTTAATGTCAAACATTTCCTTCACAAAGTTTCCGTCTTTCCTCGTCCCTCCAGAGC
 
. : . : . : . : . : . :
rJMSF037J06+ CTCTAACACTGGATGTCAAATGGTGAAGAGGTTAGTCTTTCTTCTTATGATTTCCTCCTC
rJMSF003G24+ CTCTAACACTGGATGTCAAATGGTGAAGAGGTTAGTCTTTCTTCTTATGATTTCCTCCTC
                      ____________________________________________________________
consensus CTCTAACACTGGATGTCAAATGGTGAAGAGGTTAGTCTTTCTTCTTATGATTTCCTCCTC
 
. : . : . : . : . : . :
rJMSF037J06+ CATAGTTTTACGGCTTTCTTCTCCTTTCCCTGTGTAATGATCTATTCACTTGTACAAATG
rJMSF003G24+ CATAGTTTTACGGCTTTCTTCTCCTTTCCCTGTGTAATGATCTATTCACTTGTACAAATG
                      ____________________________________________________________
consensus CATAGTTTTACGGCTTTCTTCTCCTTTCCCTGTGTAATGATCTATTCACTTGTACAAATG
 
. : . : . : . : . : . :
rJMSF037J06+ TATTGTCTTACACTCTGTAAATTAAGAAATAGAAAGATGTAC
rJMSF003G24+ TATTGTCTTACACTCTGTAAATTAAGAAATAGAAAGATGTACCTGTATCTTTTCCTGTGA
                      ____________________________________________________________
consensus TATTGTCTTACACTCTGTAAATTAAGAAATAGAAAGATGTACCTGTATCTTTTCCTGTGA