Previous Contig 011264:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS072E08Sequence612011264 (2)
JMSF003G22Sequence326018314590011264 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS072E08+ AGACCATAATTCA
                      ____________________________________________________________
consensus AGACCATAATTCA
 
. : . : . : . : . : . :
JMFS072E08+ CGGTGTAATAATTGTTAAAAAAACTCTCTATCACAAGTTGATCTCTTAAAGAAACTTCTC
                      ____________________________________________________________
consensus CGGTGTAATAATTGTTAAAAAAACTCTCTATCACAAGTTGATCTCTTAAAGAAACTTCTC
 
. : . : . : . : . : . :
JMFS072E08+ AAATCAAAATTTGAAGAAAACCTAAATAGAAACAAAAAAACTACAAATAAATTCCTAAAA
                      ____________________________________________________________
consensus AAATCAAAATTTGAAGAAAACCTAAATAGAAACAAAAAAACTACAAATAAATTCCTAAAA
 
. : . : . : . : . : . :
JMFS072E08+ ATTATACACATTGTGAAAGAGAGCAAGTACAATACCCCTATATGGCCTCATGGATGTTTC
                      ____________________________________________________________
consensus ATTATACACATTGTGAAAGAGAGCAAGTACAATACCCCTATATGGCCTCATGGATGTTTC
 
. : . : . : . : . : . :
JMFS072E08+ AAAATTCTAATTTTGGCAGTGCTAAATTGAACCAAGTATATGTGTACACCATCTTCGAGT
                      ____________________________________________________________
consensus AAAATTCTAATTTTGGCAGTGCTAAATTGAACCAAGTATATGTGTACACCATCTTCGAGT
 
. : . : . : . : . : . :
JMFS072E08+ AGCGGTTGAGGACTTCCCTATAAATCAAAGCATATG-TACAC-TTCCCACCCAAATTTGC
rJMSF003G22- GGACTTCCCTATAANTCAGAGCATATGTTACACATTNCCACCCNAATTTGC
                      ____________________________________________________________
consensus AGCGGTTGAGGACTTCCCTATAAATCAGAGCATATGTTACACATTCCCACCCAAATTTGC
 
. : . : . : . : . : . :
JMFS072E08+ ACATTACAACAACATATAAATTCTCAAATCCTACCAACCTACTCTAATTGGTCATGAAGA
rJMSF003G22- NCNTTACAACAACATATGAATTCT-ANGTCCTACCAACCTACTCTAATTGGTNATGAAGA
                      ____________________________________________________________
consensus ACATTACAACAACATATGAATTCTCAAGTCCTACCAACCTACTCTAATTGGTCATGAAGA
 
. : . : . : . : . : . :
JMFS072E08+ CATTAGGCACAACCATACATGACAGACATATCCTAAAGAAGAAAAGCACCATGCATACTC
rJMSF003G22- CATTAGGCACAACCATACATGACAGACATATCCTAAAGAAGAAAAGCACCATGCATACTC
                      ____________________________________________________________
consensus CATTAGGCACAACCATACATGACAGACATATCCTAAAGAAGAAAAGCACCATGCATACTC
 
. : . : . : . : . : . :
JMFS072E08+ TCACTCATGATAATATCATTGCCAAGTATATTGAGAATTAGCAAGACAGGTCATTGGGCC
rJMSF003G22- TCACTCNNGATAATATCNTTGCCNAGTATATTGAGAATTANCNAGACAGGTCATTGGGCC
                      ____________________________________________________________
consensus TCACTCATGATAATATCATTGCCAAGTATATTGAGAATTAGCAAGACAGGTCATTGGGCC
 
. : . : . : . : . : . :
JMFS072E08+ CTTCCAAAACCTGAATCACAGCGAAGGAAGGAAGAACCAGGGCTAGCTTCGCGTCTGCAA
rJMSF003G22- CTTCCAAAACCTGAATCACAGCGAAGGAAGGAAGAACCAGGGCTAGCTTCGCGTCTGCGA
                      ____________________________________________________________
consensus CTTCCAAAACCTGAATCACAGCGAAGGAAGGAAGAACCAGGGCTAGCTTCGCGTCTGCGA
 
. : . : . : . : . : . :
JMFS072E08+ ATGCAATAAAGCACGGCAGTGAAGCCAGAGTTTGCATTTCACCATA-GACTTGATAGTTC
rJMSF003G22- ATGCAATAAAGCACGGCAGTGAAGCCNGAGTTTGCATTTCACCATATGACTTGATAGTTC
                      ____________________________________________________________
consensus ATGCAATAAAGCACGGCAGTGAAGCCAGAGTTTGCATTTCACCATATGACTTGATAGTTC
 
. : . : . : . : . : . :
JMFS072E08+ AG
rJMSF003G22- AGATGTACATTAGATGATCCACAANCNNNANGCCGGCTTANAAAAGCAGACAAGGAGATG
                      ____________________________________________________________
consensus AGATGTACATTAGATGATCCACAANCNNNANGCCGGCTTANAAAAGCAGACAAGGAGATG
 
. : . : . : . : . : . :
rJMSF003G22- AATTGGAAAAGCTCAATGAAGACACACCANTCANATGGTTCCTCCTTTCATGGNAATCTT
                      ____________________________________________________________
consensus AATTGGAAAAGCTCAATGAAGACACACCANTCANATGGTTCCTCCTTTCATGGNAATCTT
 
. : . : . : . : . : . :
rJMSF003G22- GAAATTCTTGCACAAGGTGGTCAATANGAAATANGAAGAGTAAATTGCGTGTGGCCGGAT
                      ____________________________________________________________
consensus GAAATTCTTGCACAAGGTGGTCAATANGAAATANGAAGAGTAAATTGCGTGTGGCCGGAT
 
. : . : . : . : . : . :
rJMSF003G22- NAGGCTTTAAGCTATCACATTGAGCAGTATCTCTTCACTTGCCAAAANTGAGTTTCAGCC
                      ____________________________________________________________
consensus NAGGCTTTAAGCTATCACATTGAGCAGTATCTCTTCACTTGCCAAAANTGAGTTTCAGCC