Previous Contig 011263:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN032P01Sequence568011263 (3)gb:GMA010165_16803252e-12Glycine max mRNA for cysteine-rich polycomb-like protein (gpp1 gene).
JMSF003G16Sequence388018313gb:GMA010165_16803251e-30Glycine max mRNA for cysteine-rich polycomb-like protein (gpp1 gene).777011263 (3)gb:AJ619693_18122062e-20Lotus corniculatus var. japonicus mRNA for cysteine-rich polycomb-like protein (
JMSF027B08Sequence678019458gb:AJ619693_18122063e-09Lotus corniculatus var. japonicus mRNA for cysteine-rich polycomb-like protein (756011263 (3)gb:AJ619693_18122062e-20Lotus corniculatus var. japonicus mRNA for cysteine-rich polycomb-like protein (

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN032P01+ GACGAGACAAGTTG
                      ____________________________________________________________
consensus GACGAGACAAGTTG
 
. : . : . : . : . : . :
JMFN032P01+ GCCATGCCGAAGAATTTCGTGGCGTCGGTTCCGGTGATGCGTCCATCTCCATCTGAATCA
                      ____________________________________________________________
consensus GCCATGCCGAAGAATTTCGTGGCGTCGGTTCCGGTGATGCGTCCATCTCCATCTGAATCA
 
. : . : . : . : . : . :
JMFN032P01+ GCGCAGGCGAACCATTCCTTATATGTCTTCTCGTGTTCTTTGGAGCAGCGGTTAATCGGA
                      ____________________________________________________________
consensus GCGCAGGCGAACCATTCCTTATATGTCTTCTCGTGTTCTTTGGAGCAGCGGTTAATCGGA
 
. : . : . : . : . : . :
JMFN032P01+ GCATCATCGATGTCCAGGAACGACTCCCTTCCTTTTGAACTGCTATTATCCAGCGTCTTC
                      ____________________________________________________________
consensus GCATCATCGATGTCCAGGAACGACTCCCTTCCTTTTGAACTGCTATTATCCAGCGTCTTC
 
. : . : . : . : . : . :
JMFN032P01+ CCCTTTGAATCCTCCCTTTTGAAACTAGCTCGAAAACTGTTCATCATCTTCAAACAATTC
                      ____________________________________________________________
consensus CCCTTTGAATCCTCCCTTTTGAAACTAGCTCGAAAACTGTTCATCATCTTCAAACAATTC
 
. : . : . : . : . : . :
JMFN032P01+ ACTCAGCCTCGCCGGAGAAGTTACTGTATGTATGTTCGTCTGTTCCCTCCACCACGTTTA
                      ____________________________________________________________
consensus ACTCAGCCTCGCCGGAGAAGTTACTGTATGTATGTTCGTCTGTTCCCTCCACCACGTTTA
 
. : . : . : . : . : . :
JMFN032P01+ GTTAATACAAAATTGGGACCAAAGAATTTTATGAGTCTATCAACTCTGATAAGAGCTCAT
rJMSF027B08+ TGGGACCAAAGAATTTTATGAGTCTATCAACTCTGATAAGAGCTCAT
rJMSF003G16+ TGGGACCAAAGAATTTTATGAGTCTATCAACTCTGATAAGAGCTCAT
                      ____________________________________________________________
consensus GTTAATACAAAATTGGGACCAAAGAATTTTATGAGTCTATCAACTCTGATAAGAGCTCAT
 
. : . : . : . : . : . :
JMFN032P01+ TTAATGCGATTGAAGATGACACACCAGAGATACTGAAGGATGCTTCTACTCCACCCCGGG
rJMSF027B08+ TTAATGCGATTGAAGATGACACACCAGAGATACTGAAGGATGCTTCTACTCCACCCCGGG
rJMSF003G16+ TTAATGCGATTGAAGATGACACACCAGAGATACTGAAGGATGCTTCTACTCCACCCCGGG
                      ____________________________________________________________
consensus TTAATGCGATTGAAGATGACACACCAGAGATACTGAAGGATGCTTCTACTCCACCCCGGG
 
. : . : . : . : . : . :
JMFN032P01+ GCGTGAAAGTAAGCTCCCCAAATAAGAAGCGGGTTTCTCCCCCTCATGATCGCCTGAAAG
rJMSF027B08+ GCGTGAAAGTAAGCTCCCCAAATAAGAAGCGGGTTTCTCCCCCTCATGATCGCCTGAAAG
rJMSF003G16+ GCGTGAAAGTAAGCTCCCCAAATAAGAAGCGGGTTTCTCCCCCTCATGATCGCCTGAAAG
                      ____________________________________________________________
consensus GCGTGAAAGTAAGCTCCCCAAATAAGAAGCGGGTTTCTCCCCCTCATGATCGCCTGAAAG
 
. : . : . : . : . : . :
JMFN032P01+ ATCCTGATGGTAGCTCATCTGCTCGGCGCCTGAAAGCTGGCCGGAAATATAAATTAGGGT
rJMSF027B08+ ATCCTGATGGTAGCTCATCTGCTCGGCGCCTGAAAGCTGGCCGGAAATATAAATTAGGGT
rJMSF003G16+ ATCCTGATGGTAGCTCATCTGCTCGGCGCCTGAAAGCTGGCCGGAAATATAAATTAGGGT
                      ____________________________________________________________
consensus ATCCTGATGGTAGCTCATCTGCTCGGCGCCTGAAAGCTGGCCGGAAATATAAATTAGGGT
 
. : . : . : . : . : . :
JMFN032P01+ CTGTTCCTTCTTTC
rJMSF027B08+ CTGTTCCTTCTTTCCCCCCTCTTACGCCATGCTTTGTTTCTAAAGGCAGCAGTGAAGGTC
rJMSF003G16+ CTGTTCCTTCTTTCCCCCCTCTTACGCCATGCTTTGTTTCTAAAGGCAGCAGTGAAGGTC
                      ____________________________________________________________
consensus CTGTTCCTTCTTTCCCCCCTCTTACGCCATGCTTTGTTTCTAAAGGCAGCAGTGAAGGTC
 
. : . : . : . : . : . :
rJMSF027B08+ AGATTAAAAATGATCCTCAGAAACCTAGTAGCAGCACTTGATTCAAACCAGGAAAGGATC
rJMSF003G16+ AGATTAAAAATGATCCTCAGAAACCTAGTAGCAGCACTTGATTCAAACCAGGAAAGGATC
                      ____________________________________________________________
consensus AGATTAAAAATGATCCTCAGAAACCTAGTAGCAGCACTTGATTCAAACCAGGAAAGGATC
 
. : . : . : . : . : . :
rJMSF027B08+ CACGGTGCAATGTTAGCCCTGTGACCTAATTGAAAAGGAGGAGGTTGTCTTGTATTGATC
rJMSF003G16+ CACGGTGCAGTGTTAGCCCTGTGACCTAATTGAAAAGGAGGAGGTTGTCTTGTATTGATC
                      ____________________________________________________________
consensus CACGGTGCAGTGTTAGCCCTGTGACCTAATTGAAAAGGAGGAGGTTGTCTTGTATTGATC
 
. : . : . : . : . : . :
rJMSF027B08+ AAACTCAAGTGTCAAATTGAAGATGCTCAAGTTGGTTAGTAGCGCACTTTTTTCTTCATC
rJMSF003G16+ AAACTCAAGTGTCAAATTGAAGATGCTCAAGTTGGTTAGTAGCGCACTTTTTTCTTCATC
                      ____________________________________________________________
consensus AAACTCAAGTGTCAAATTGAAGATGCTCAAGTTGGTTAGTAGCGCACTTTTTTCTTCATC
 
. : . : . : . : . : . :
rJMSF027B08+ GTATCTATTGTGATTCTTTATAGCCTGCAGCAATCGGTTTTATATTAGTCGATATATATG
rJMSF003G16+ GTATCTATTGTGATTCTTTATAGCCTGCAGCAATCGGTTTTATATTAGTCGATATATATG
                      ____________________________________________________________
consensus GTATCTATTGTGATTCTTTATAGCCTGCAGCAATCGGTTTTATATTAGTCGATATATATG
 
. : . : . : . : . : . :
rJMSF027B08+ CTGCTGTATTATTTCTA-CAGTTGTAAACTGATGATAGCAGGCAACCATTGTACCTTGCT
rJMSF003G16+ CTGCTGTATTATTTCTACCAGTTGT-AACTGATGATAGCAGGCAA-CATTGTACCTTGCT
                      ____________________________________________________________
consensus CTGCTGTATTATTTCTACCAGTTGTAAACTGATGATAGCAGGCAACCATTGTACCTTGCT