Previous Contig 011262:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003G04Sequence344011262 (2)gb:AY072344_15671614e-05Arabidopsis thaliana plastid ribosomal protein S6, putative (At1g64510) mRNA, co724011262 (2)gb:AY072344_15671611e-64Arabidopsis thaliana plastid ribosomal protein S6, putative (At1g64510) mRNA, co

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF003G04- GGTCACGCTT
                      ____________________________________________________________
consensus GGTCACGCTT
 
. : . : . : . : . : . :
JMSF003G04- TCGCAGTTGAGCTCGCTCGCTCGCTCTCATTGAAGCTCAGCTCAGCTCAATGACAATGGC
                      ____________________________________________________________
consensus TCGCAGTTGAGCTCGCTCGCTCGCTCTCATTGAAGCTCAGCTCAGCTCAATGACAATGGC
 
. : . : . : . : . : . :
JMSF003G04- TGCTGCTTCTTCTTCTTCATCTATAATCCCAACCCTGTCCTCCTCACCCTCCACCTTATC
                      ____________________________________________________________
consensus TGCTGCTTCTTCTTCTTCATCTATAATCCCAACCCTGTCCTCCTCACCCTCCACCTTATC
 
. : . : . : . : . : . :
JMSF003G04- CCTGCTTCATTCTCCCTCTCCTTCATTCGTCGTCTTCAAGGCCGTCCCCGGCGCCTCAAG
rJMSF003G04+ CAAG
                      ____________________________________________________________
consensus CCTGCTTCATTCTCCCTCTCCTTCATTCGTCGTCTTCAAGGCCGTCCCCGGCGCCTCAAG
 
. : . : . : . : . : . :
JMSF003G04- GCCACTGCTGCGCCACAAAAAATGGAACAAGCATTCCGAGGTGGTCGTCAAGGCCGAAAC
rJMSF003G04+ GCCACTGCTGCGCCACAAAAAATGGAACAAGCATTCCGAGGTGGTCGTCAAGGCCGAAAC
                      ____________________________________________________________
consensus GCCACTGCTGCGCCACAAAAAATGGAACAAGCATTCCGAGGTGGTCGTCAAGGCCGAAAC
 
. : . : . : . : . : . :
JMSF003G04- ATTGGAGTTCTCCGGATCGTTATTTGAAGGCGGGATTGGAGAAGACGACGAGCCGCCATC
rJMSF003G04+ ATTGGAGTTCTCCGGATCGTTATTTGAAGGCGGGATTGGAGAAGACGACGAGCCGCCATC
                      ____________________________________________________________
consensus ATTGGAGTTCTCCGGATCGTTATTTGAAGGCGGGATTGGAGAAGACGACGAGCCGCCATC
 
. : . : . : . : . : . :
JMSF003G04- GATTCCCGGCTGGGGTATTTCCAATATTGAAGAT
rJMSF003G04+ GATTCCCGGCTGGGGTATTTCCAATATTGAAGATAAAGAGGAGCCCCAGTGTCCTCCGGG
                      ____________________________________________________________
consensus GATTCCCGGCTGGGGTATTTCCAATATTGAAGATAAAGAGGAGCCCCAGTGTCCTCCGGG
 
. : . : . : . : . : . :
rJMSF003G04+ GCTGAGGCAGTATGAAACCATGGCGGTTCTGCGCCCTGACCTGTCGGAAGATGAGCGCCT
                      ____________________________________________________________
consensus GCTGAGGCAGTATGAAACCATGGCGGTTCTGCGCCCTGACCTGTCGGAAGATGAGCGCCT
 
. : . : . : . : . : . :
rJMSF003G04+ AACTCTCGTCTCCAAATATGAAGAGTTGCTTGTTGCTGGTGGCGGGATGTATGTGGAGGT
                      ____________________________________________________________
consensus AACTCTCGTCTCCAAATATGAAGAGTTGCTTGTTGCTGGTGGCGGGATGTATGTGGAGGT
 
. : . : . : . : . : . :
rJMSF003G04+ GTTTAACCGAGGGGTTATTCCTCTCGCTTACAACATCAAGAAGAAAAACAAAGCCGGAGA
                      ____________________________________________________________
consensus GTTTAACCGAGGGGTTATTCCTCTCGCTTACAACATCAAGAAGAAAAACAAAGCCGGAGA
 
. : . : . : . : . : . :
rJMSF003G04+ GACCAACACCTACATGGATGGGATTTATCTCCTATTCACCTATTTTACCAAGCCGGAGTC
                      ____________________________________________________________
consensus GACCAACACCTACATGGATGGGATTTATCTCCTATTCACCTATTTTACCAAGCCGGAGTC
 
. : . : . : . : . : . :
rJMSF003G04+ CATAGCAGCCCTTGAAGCCACAATGAATACCGACGATGATGTCATCCGTTCATCCAGTTT
                      ____________________________________________________________
consensus CATAGCAGCCCTTGAAGCCACAATGAATACCGACGATGATGTCATCCGTTCATCCAGTTT
 
. : . : . : . : . : . :
rJMSF003G04+ CAAGTTGAGGAAAAGGAAGTTTTGATTTGCTTGCTTGCTTACATCATCCAGGAAGCTGTT
                      ____________________________________________________________
consensus CAAGTTGAGGAAAAGGAAGTTTTGATTTGCTTGCTTGCTTACATCATCCAGGAAGCTGTT
 
. : . : . : . : . : . :
rJMSF003G04+ CTTTTAAGATTTAGCCATGTTTTTGAGGTAATTTGGAAATAAGGACAAAAAAAATGCAGG
                      ____________________________________________________________
consensus CTTTTAAGATTTAGCCATGTTTTTGAGGTAATTTGGAAATAAGGACAAAAAAAATGCAGG
 
. : . : . : . : . : . :
rJMSF003G04+ TATATTTGTTTCTACTGACAATCTGACATGTACAATGCAATTTCATGTTATGAAGCTGTG
                      ____________________________________________________________
consensus TATATTTGTTTCTACTGACAATCTGACATGTACAATGCAATTTCATGTTATGAAGCTGTG
 
. : . : . : . : . : . :
rJMSF003G04+ CATAGGATTTTAGTATGAGAATCTGATTAATCCCCAGATTCTGCACTAATCCTTAAACAA
                      ____________________________________________________________
consensus CATAGGATTTTAGTATGAGAATCTGATTAATCCCCAGATTCTGCACTAATCCTTAAACAA