Previous Contig 011260:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003F16Sequence247005598 (7)sp|P21342|PFPA_SOLTU5e-27Pyrophosphate--fructose 6-phosphate 1-phosphotransferase alpha subunit (EC 2.7.1767011260 (4)gb:AF095521_17677667e-86Citrus X paradisi pyrophosphate-dependent phosphofructokinase alpha subunit (PPi
JMSF016C08Sequence488005598 (7)sp|P21342|PFPA_SOLTU6e-62Pyrophosphate--fructose 6-phosphate 1-phosphotransferase alpha subunit (EC 2.7.1733011260 (4)gb:AF095521_17677668e-78Citrus X paradisi pyrophosphate-dependent phosphofructokinase alpha subunit (PPi
JMSF041I12Sequence808005598 (7)gb:AF095521_1767766e-115Citrus X paradisi pyrophosphate-dependent phosphofructokinase alpha subunit (PPi802011260 (4)gb:AF095521_17677664e-94Citrus X paradisi pyrophosphate-dependent phosphofructokinase alpha subunit (PPi
JMSF046K22Sequence755005598 (7)gb:AF095521_1767766e-107Citrus X paradisi pyrophosphate-dependent phosphofructokinase alpha subunit (PPi134011260 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF041I12+ TNCANGGGGAAGAAATTCAATGCTATTTG
                      ____________________________________________________________
consensus TNCANGGGGAAGAAATTCAATGCTATTTG
 
. : . : . : . : . : . :
rJMSF041I12+ CCATTTCTTTGGTTATCAAGCTCGGGGATCACTGCCATCGAAGTTTGATTGTGACTATGC
rJMSF016C08+ ATTGTGACTATGC
rJMSF003F16+ TATCAAGCTCGGGGATCACTGCCATCGAAGTTTGATTGTGACTATGC
                      ____________________________________________________________
consensus CCATTTCTTTGGTTATCAAGCTCGGGGATCACTGCCATCGAAGTTTGATTGTGACTATGC
 
. : . : . : . : . : . :
rJMSF041I12+ TTATGTGCTTGGTCATGTCTGTTACCATATTTTGGCTGCTGGCTTGAATGGTTACTTGGC
rJMSF016C08+ TTATGTGCTTGGTCATGTCTGTTACCATATTTTGGCTGCTGGCTTGAATGGTTACTTGGC
rJMSF003F16+ TTATGTGCTTGGTCATGTCTGTTACCATATTTTGGCTGCTGGCTTGAATGGTTACTTGGC
                      ____________________________________________________________
consensus TTATGTGCTTGGTCATGTCTGTTACCATATTTTGGCTGCTGGCTTGAATGGTTACTTGGC
 
. : . : . : . : . : . :
rJMSF041I12+ AACTTTAAATAACCTGAAGAATCCTGTGAATAAGTGGCGTTGTGGTGCTGCTCCAATAAC
rJMSF016C08+ AACTTTAAATAACCTGAAGAATCCTGTGAATAAGTGGCGTTGTGGTGCTGCTCCAATAAC
rJMSF003F16+ AACTTTAAATAACCTGAAGAATCCTGTGAATAAGTGGCGTTGTGGTGCTGCTCCAATAAC
                      ____________________________________________________________
consensus AACTTTAAATAACCTGAAGAATCCTGTGAATAAGTGGCGTTGTGGTGCTGCTCCAATAAC
 
. : . : . : . : . : . :
rJMSF041I12+ TGCTATGATGACTGTCAGGCGTTATGGTCATGGTCCTGCTGCTGATTCCTTTGGGAAGCC
rJMSF016C08+ TGCTATGATGACTGTCAGGCGTTATGGTCATGGTCCNGCTGCTGATTCCTTTGGGAAGCC
rJMSF003F16+ TGCTATGATGACTGTCAGGCGTTATGGTCATGGTCCTGCTGCTGATTCCTTTGGGAAGCC
                      ____________________________________________________________
consensus TGCTATGATGACTGTCAGGCGTTATGGTCATGGTCCTGCTGCTGATTCCTTTGGGAAGCC
 
. : . : . : . : . : . :
rJMSF041I12+ TGCTCTTCATCCTGCTACTGTTGATTTAAGAGGCAAAGCATATGAGCTTCTGAGACAGAA
rJMSF016C08+ TGCTCTTCATCCTGCTACTGTTGATTTAAGAGGCAAAGCATATGAGCTTCTGAGACAGAA
rJMSF003F16+ TGCTCTTCATCCTGCTACTGTTGATTTAAGAGGCAAAGCATATGAGCTTCTGAGACAGAA
                      ____________________________________________________________
consensus TGCTCTTCATCCTGCTACTGTTGATTTAAGAGGCAAAGCATATGAGCTTCTGAGACAGAA
 
. : . : . : . : . : . :
rJMSF041I12+ TGCCACAAAATTCTTGTTGGACGATGTCTACAGGAATCCTGGACCTCTTCAGTTTGATGG
rJMSF016C08+ TGCCACAAAATTCTTGTTGGNCGATGTCTACAGGAATCCTGGACCTCTTCAGTTTGATGG
rJMSF003F16+ TGCCACAAAATTCTTGTTGGACGATGTCTACAGGAATCCTGGACCTCTTCAGTTTGATGG
                      ____________________________________________________________
consensus TGCCACAAAATTCTTGTTGGACGATGTCTACAGGAATCCTGGACCTCTTCAGTTTGATGG
 
. : . : . : . : . : . :
rJMSF041I12+ CCCAGGTGCTGATGCAAAGGCTTTAATCCTTTGTGTTGAGGACCAGGATTACATGGGCCG
rJMSF016C08+ CCCAGGTGCTGATGCAAAGGCTTTAATCCTTTGTGTTGAGGACCAGGATTACATGGGCCG
rJMSF003F16+ CCCAGGTGCTGATGCAAAGGCTTTAATCCTTTGTGTTGAGGACCAGGATTACATGGGCCG
                      ____________________________________________________________
consensus CCCAGGTGCTGATGCAAAGGCTTTAATCCTTTGTGTTGAGGACCAGGATTACATGGGCCG
 
. : . : . : . : . : . :
rJMSF041I12+ GATCAAGGAATTGCAGGAATATCTTGATAAGGTACGCACCATTGTGAAACCAGGTTGCTC
rJMSF016C08+ GATCAAGGAATTGCAGGAATATCTTGATAAGGTACGCACCATTGTGAAACCAGGTTGCTC
rJMSF003F16+ GATCAAGGAATTGCAGGAATATCTTGATAAGGTACGCACCATTGTGAAACCAGGTTGCTC
                      ____________________________________________________________
consensus GATCAAGGAATTGCAGGAATATCTTGATAAGGTACGCACCATTGTGAAACCAGGTTGCTC
 
. : . : . : . : . : . :
rJMSF041I12+ ACAGGATGTGCTGAAAGCAGCTTTAAGTGCCATGGCTTCTGTAACAAATATTCTCTCAGT
rJMSF016C08+ ACAGGATGTGCTGAAAGCAGCTTTAAGTGCCATGGCTTCTGTAACAAATATTCTCTCAGT
rJMSF003F16+ ACAGGATGTGCTGAAAGCAGCTTTAAGTGCCATGGCTTCTGTAACAAATATTCTCTCAGT
                      ____________________________________________________________
consensus ACAGGATGTGCTGAAAGCAGCTTTAAGTGCCATGGCTTCTGTAACAAATATTCTCTCAGT
 
. : . : . : . : . : . :
rJMSF041I12+ TATGTCAAATGGTGGTAACACAAACTTCTAAGCAAGAGCAGACTATTGGTCTATCTCAGA
rJMSF016C08+ TATGTCAAATGGTGGTAACACAAACTTCTAAGCAAGAGCAGACTATTGGTCTATCTCAGA
rJMSF046K22+ TCTAAGCAAGAGCAGANNANTGGTCTATNTCAGA
rJMSF003F16+ TATGTCAAATGGTGGTAACACAAACTTCTAAGCAAGAGCAGACTATTGGTCTATCTCAGA
                      ____________________________________________________________
consensus TATGTCAAATGGTGGTAACACAAACTTCTAAGCAAGAGCAGACTATTGGTCTATCTCAGA
 
. : . : . : . : . : . :
rJMSF041I12+ AATTTTGTGGCTCTATTGCTGCTAGACTGCACCTTTGTTGGATATCAATTTAGGTGCAAA
rJMSF016C08+ AATTTTGTGGCTCTATTGCTGCTAGACTGCACCTTTGTTGGATATCAATTTAGGTGCAAA
rJMSF046K22+ NATTNNGTGGCTCTATTGCNGCTAGNCTGCACCTNTGTTGGATATCAANTNAGGTGCAAA
rJMSF003F16+ AATTTTGTGGCTCTATTGCTGCTAGACTGCACCTTTGTTGGATATCAATTTAGGTGCAAA
                      ____________________________________________________________
consensus AATTTTGTGGCTCTATTGCTGCTAGACTGCACCTTTGTTGGATATCAATTTAGGTGCAAA
 
. : . : . : . : . : . :
rJMSF041I12+ ACAATTAGGTTATGGTGTGGAACGTATCTTTAGTTTTAGTTACTGTCTTTTGACCCCTGT
rJMSF016C08+ ACAATTAGGTTATGGTGTGGAACGTATCTTTAGTTTTAGTTACTGTCTTTTGACCCCTGT
rJMSF046K22+ ACAANTCGGTTANGGTGTGGAACGTATCTTTNGTTTTA
rJMSF003F16+ ACAATTAGGTTATGGTGTGGAACGTATCTTTAGTTTTAGTTACTGTCTTTTGACCCCTGT
                      ____________________________________________________________
consensus ACAATTAGGTTATGGTGTGGAACGTATCTTTAGTTTTAGTTACTGTCTTTTGACCCCTGT
 
. : . : . : . : . : . :
rJMSF041I12+ AATTTTGAGTTGCGAAGTAATTTCATGAATTGTTACTGCGGGATGAGGAAGGA
rJMSF016C08+ AATTTTGAGTTGCGAAGTAATTTCATGAATTGTTACTGCGGGATGAGGAAGGA
rJMSF003F16+ AATTTTGAGTTGCGAAGTAATTTCATGAATTGTTACTGCGGGATGAGGAAGGATTCTTAT
                      ____________________________________________________________
consensus AATTTTGAGTTGCGAAGTAATTTCATGAATTGTTACTGCGGGATGAGGAAGGATTCTTAT