Previous Contig 011259:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003F14Sequence389004505 (3)gb:AC006439_15342945e-10Arabidopsis thaliana chromosome 2 clone T30D6 map mi39, complete sequence.>gb:AY763011259 (3)gb:AP005323_18506412e-63Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P068
JMSF017O20Sequence243004505 (3)781011259 (3)gb:AP005323_18506413e-75Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P068
JMSF025G21Sequence678004505 (3)gb:AC006439_15342942e-58Arabidopsis thaliana chromosome 2 clone T30D6 map mi39, complete sequence.>gb:AY749011259 (3)gb:AP005323_18506416e-69Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P068

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF025G21+ TCCAAGAAGGGCTTA
rJMSF017O20+ AATTCATGAGATTTTTGACTGGGCCAAAAAATCCAAGAAGGGCTTA
                      ____________________________________________________________
consensus AATTCATGAGATTTTTGACTGGGCCAAAAAATCCAAGAAGGGCTTA
 
. : . : . : . : . : . :
rJMSF025G21+ TTGCTTTTCATTGACGAGGCTGATGCCTTCTTATGCGAGCGAAACAGCATACACATGAGT
rJMSF017O20+ TTGCTTTTCATTGACGAGGCTGATGCCTTCTTATGCGAGCGAAACAGCATACACATGAGT
rJMSF003F14+ GGCTGATGCCTTTTTATGCGAGCGAAACAGCATACACATGAGT
                      ____________________________________________________________
consensus TTGCTTTTCATTGACGAGGCTGATGCCTTCTTATGCGAGCGAAACAGCATACACATGAGT
 
. : . : . : . : . : . :
rJMSF025G21+ GAAGCTCAGCGGAGTGCTTTAAACGCTATGCTCTTTCGAACAGGAGACCAGTCCCGGGAT
rJMSF017O20+ GAAGCTCAGCGGAGTGCTTTAAACGCTATGCTCTTTCGAACAGGAGACCAGTCCCGGGAT
rJMSF003F14+ GAAGCTCAGCGGAGTGCTTTAAACGCTATGCTCTTTCGAACAGGAGACCAGTCCCGGGAT
                      ____________________________________________________________
consensus GAAGCTCAGCGGAGTGCTTTAAACGCTATGCTCTTTCGAACAGGAGACCAGTCCCGGGAT
 
. : . : . : . : . : . :
rJMSF025G21+ GTGGTTCTTGTCCTCGCAACCAACAGGCCAGGGGATCTTGACAGTGCCATCACCGACCGC
rJMSF017O20+ GTGGTTCTTGTCCTCGCAACCAACAGGCCAGGGGATCTTGACAGTGCCATCACCGACCGC
rJMSF003F14+ GTGGTTCTTGTCCTCGCAACCAACAGGCCAGGGGATCTTGACAGTGCCATCACCGACCGC
                      ____________________________________________________________
consensus GTGGTTCTTGTCCTCGCAACCAACAGGCCAGGGGATCTTGACAGTGCCATCACCGACCGC
 
. : . : . : . : . : . :
rJMSF025G21+ ATAGATGAAGTCATTGAATTCCCTCTTCCCCAGGAGGAAGAGCGTTTCAAATTGCTGAAG
rJMSF017O20+ ATAGATGAAGTCATTGAATTCCCTCTTCCCCAGGAGGAAGAGCGTTTCAAATTGCTGAAG
rJMSF003F14+ ATAGATGAAGTCATTGAATTCCCTCTTCCCCAGGAGGAAGAGCGTTTCAAATTGCTGAAG
                      ____________________________________________________________
consensus ATAGATGAAGTCATTGAATTCCCTCTTCCCCAGGAGGAAGAGCGTTTCAAATTGCTGAAG
 
. : . : . : . : . : . :
rJMSF025G21+ CTGTATCTGAACAAATACCTCTCCGGCGAAGAAGGCAGCAACGACTCCAAGTGGGGAGGA
rJMSF017O20+ CTGTATCTGAACAAATACCTCTCCGGCGAAGAAGGCAGCAACGACTCCAAGTGGGGAGGA
rJMSF003F14+ CTGTATCTGAACAAATACCTCTCCGGCGAAGAAGGCAGCAACGACTCCAAGTGGGGAGGA
                      ____________________________________________________________
consensus CTGTATCTGAACAAATACCTCTCCGGCGAAGAAGGCAGCAACGACTCCAAGTGGGGAGGA
 
. : . : . : . : . : . :
rJMSF025G21+ GGTTTGTTTAATAAGCAACCACAAAAAATCACAGTAAAAGACATATCCGATGATATAATC
rJMSF017O20+ GGTTTGTTTAATAAGCAACCACAAAAAATCACAGTAAAAGACATATCCGATGATATAATC
rJMSF003F14+ GGTTTGTTTAATAAGCAACCACAAAAAATCACAGTAAAAGACATATCCGATGATATAATC
                      ____________________________________________________________
consensus GGTTTGTTTAATAAGCAACCACAAAAAATCACAGTAAAAGACATATCCGATGATATAATC
 
. : . : . : . : . : . :
rJMSF025G21+ AGAGAGGCTGCTCGGAGGACGGAGGGGTTTTCCGGCCGAGAGATCGCCAAACTCATGGCT
rJMSF017O20+ AGAGAGGCTGCTCGGAGGACGGAGGGGTTTTCCGGCCGAGAGATCGCCAAACTCATGGCT
rJMSF003F14+ AGAGAGGCTGCTCGGAGGACGGAGGGGTTTTCCGGCCGAGAGATCGCCAAACTCATGGCT
                      ____________________________________________________________
consensus AGAGAGGCTGCTCGGAGGACGGAGGGGTTTTCCGGCCGAGAGATCGCCAAACTCATGGCT
 
. : . : . : . : . : . :
rJMSF025G21+ AGCGTGCAGGCGGCCGTTTACGGCAGCCCTGATTGCGTCCTGCATCCCCAGCTCTTCAAG
rJMSF017O20+ AGCGTGCAGGCGGCCGTTTACGGCAGCCCTGATTGCGTCCTGCATCCCCAGCTCTTCAAG
rJMSF003F14+ AGCGTGCAGGCGGCCGTTTACGGCAGCCCTGATTGCGTCCTGCATCCCCAGCTCTTCAAG
                      ____________________________________________________________
consensus AGCGTGCAGGCGGCCGTTTACGGCAGCCCTGATTGCGTCCTGCATCCCCAGCTCTTCAAG
 
. : . : . : . : . : . :
rJMSF025G21+ GAGATTGTGGACTACAAAGTTGCAGAGCATCAGCAGCGCATTCAACTTGCAGCTGAAGGT
rJMSF017O20+ GAGATTGTGGACTACAAAGTTGCAGAGCATCAGCAGCGCATTCAACTTGCAGCTGAAGGT
rJMSF003F14+ GAGATTGTGGACTACAAAGTTGCAGAGCATCAGCAGCGCATTCAACTTGCAGCTGAAGGT
                      ____________________________________________________________
consensus GAGATTGTGGACTACAAAGTTGCAGAGCATCAGCAGCGCATTCAACTTGCAGCTGAAGGT
 
. : . : . : . : . : . :
rJMSF025G21+ GGAGAGCCTGCTTTCTGCACCAATTAGCTGCCAAATTTTTTATCAAACTATAGAGATCTC
rJMSF017O20+ GGAGAGCCTGCTTTCTGCACCAATTAGCTGCCAAATTTTTTATCAAACTATAGAGATCTC
rJMSF003F14+ GGAGAGCCTGCTTTCTGCACCAATTAGCTGCCAAATTTTTTATCAAACTATAGAGATCTC
                      ____________________________________________________________
consensus GGAGAGCCTGCTTTCTGCACCAATTAGCTGCCAAATTTTTTATCAAACTATAGAGATCTC
 
. : . : . : . : . : . :
rJMSF025G21+ TTGCAGAGTTATTCTTATCATCTCATCAGGCATAACTATGTAAAAGTAGAATCCAAAGTA
rJMSF017O20+ TTGCAGAGTTATTCTTATCATCTCATCAGGCATAACTATGTAAAAGTAGAATCCAAAGTA
rJMSF003F14+ TTGCAGAGTTATTCTTATCATCTCATCAGGCATAACTATGTAAAAGTAGAATCCAAAGTA
                      ____________________________________________________________
consensus TTGCAGAGTTATTCTTATCATCTCATCAGGCATAACTATGTAAAAGTAGAATCCAAAGTA
 
. : . : . : . : . : . :
rJMSF025G21+ CATTACTCGATACTTCATGTGAGTATATACTTTTAGGATTCAAAACGTTTCAGTTTTGTG
rJMSF017O20+ CATTACTCGATACTTCATGTGAGTATATACTTTTAGGATTCAAAACGTTTCAGTTTTGTG
rJMSF003F14+ CATTACTCGATACTTCATGTGAGTATATACTTTTAGGATTCAAAACGTTTCAGTTTTGTG
                      ____________________________________________________________
consensus CATTACTCGATACTTCATGTGAGTATATACTTTTAGGATTCAAAACGTTTCAGTTTTGTG
 
. : . : . : . : . : . :
rJMSF025G21+ -TTGAAACCCTATAT
rJMSF017O20+ TTTGAAACCCTATAT
rJMSF003F14+ TTTGAAACCCTATATTGTATACATTTTATTAGTAATAATAACTGCACGATTTGAATTCTT
                      ____________________________________________________________
consensus TTTGAAACCCTATATTGTATACATTTTATTAGTAATAATAACTGCACGATTTGAATTCTT