Previous Contig 011257:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020I15Sequence527006733 (3)gb:AF329506_17869912e-54Glycine max mitogen-activated protein kinase 2 mRNA, complete cds.722011257 (4)gb:NTU94192_1691927e-101Nicotiana tabacum salicylic acid-activated MAP kinase (NtSIPK) mRNA, complete cd
JMSF003F10Sequence439018310gb:AF329506_17869919e-29Glycine max mitogen-activated protein kinase 2 mRNA, complete cds.747011257 (4)gb:NTU94192_16919271e-94Nicotiana tabacum salicylic acid-activated MAP kinase (NtSIPK) mRNA, complete cd
JMSF007E18Sequence484006733 (3)gb:AF329506_17869913e-49Glycine max mitogen-activated protein kinase 2 mRNA, complete cds.785011257 (4)gb:NTU94192_1691927e-102Nicotiana tabacum salicylic acid-activated MAP kinase (NtSIPK) mRNA, complete cd
JMSF031G01Sequence670006733 (3)gb:AF329506_17869911e-72Glycine max mitogen-activated protein kinase 2 mRNA, complete cds.764011257 (4)gb:NTU94192_1691927e-113Nicotiana tabacum salicylic acid-activated MAP kinase (NtSIPK) mRNA, complete cd

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF031G01+ GAAATACATACATTCTGCAAATG
                      ____________________________________________________________
consensus GAAATACATACATTCTGCAAATG
 
. : . : . : . : . : . :
rJMSF031G01+ TTTGCACAGGGACTTGAAGCCCAGCAATCTACTATTGAATGCCAATTGTGATCTGAAAAT
rJMFF020I15+ GAAAAT
rJMSF007E18+ GAAAAT
                      ____________________________________________________________
consensus TTTGCACAGGGACTTGAAGCCCAGCAATCTACTATTGAATGCCAATTGTGATCTGAAAAT
 
. : . : . : . : . : . :
rJMSF031G01+ ATGTGATTTTGGATTAGCTCGTGTGACATCCGAAACAGATTTTATGACTGAATATGTTGT
rJMFF020I15+ ATGTGATTTTGGATTAGCTCGTGTGACATCCGAAACAGATTTTATGACTGAATATGTTGT
rJMSF007E18+ ATGTGATTTTGGATTAGCTCGTGTGACATCCGAAACAGATTTTATGACTGAATATGTTGT
rJMSF003F10+ AACAGATTTTATGACTGAATATGTTGT
                      ____________________________________________________________
consensus ATGTGATTTTGGATTAGCTCGTGTGACATCCGAAACAGATTTTATGACTGAATATGTTGT
 
. : . : . : . : . : . :
rJMSF031G01+ GACTAGATGGTACCGGCCACCTGAGCTATTATTGAACTCTTCTGACTACACTGCAGCCAT
rJMFF020I15+ GANTAGATGGTACCGGCCACCTGAGCTATTATTGAACTCTTCTGACTACACTGCAGCCAT
rJMSF007E18+ GACTAGATGGTACCGGCCACCTGAGCTATTATTGAACTCTTCTGACTACACTGCAGCCAT
rJMSF003F10+ GACTAGATGGTACCGGCCACCTGAGCTATTATTGAACTCTTCTGACTACACTGCAGCCAT
                      ____________________________________________________________
consensus GACTAGATGGTACCGGCCACCTGAGCTATTATTGAACTCTTCTGACTACACTGCAGCCAT
 
. : . : . : . : . : . :
rJMSF031G01+ TGATGTATGGTCAGTGGGTTGTATTTTCATGGAATTGATGGATCGGAAACCCCTATTCCC
rJMFF020I15+ TGATGTATGGTCAGTGGGTTGTATTTTCATGGGATTGATGGATCGGAAACCCCTATTCCC
rJMSF007E18+ TGATGTATGGTCAGTGGGTTGTATTTTCATGGAATTGATGGATCGGAAACCCCTATTCCC
rJMSF003F10+ TGATGTATGGTCAGTGGGTTGTATTTTCATGGAATTGATGGATCGGAAACCCCTATTCCC
                      ____________________________________________________________
consensus TGATGTATGGTCAGTGGGTTGTATTTTCATGGAATTGATGGATCGGAAACCCCTATTCCC
 
. : . : . : . : . : . :
rJMSF031G01+ TGGTAGAGATCATGTCCACCAGCTACGTCTGCTTATGGAGCTAATAGGTACACCTTCGGA
rJMFF020I15+ TGGTAGAGATCATGTCCACCAGCTACGTCTGCTTATGGAGCTAATAGGTACACCTTCGGA
rJMSF007E18+ TGGTAGAGATCATGTCCACCAGCTACGTCTGCTTATGGAGCTAATAGGTACACCTTCGGA
rJMSF003F10+ TGGTAGAGATCATGTCCACCAGCTACGTCTGCTTATGGAGCTAATAGGTACACCTTCGGA
                      ____________________________________________________________
consensus TGGTAGAGATCATGTCCACCAGCTACGTCTGCTTATGGAGCTAATAGGTACACCTTCGGA
 
. : . : . : . : . : . :
rJMSF031G01+ GGCTGAAATGGAGTTTTTGAATGAGAATGCGAAAAAATATATCCGGCAGCTTCCATTATA
rJMFF020I15+ GGCTGAAATGGAGTTTTTGAATGAGAATGCGAAAAAATATATCCGGCAGCTTCCATTATA
rJMSF007E18+ GGCTGAAATGGAGTTTTTGAATGAGAATGCGAAAAAATATATCCGGCAGCTTCCATTATA
rJMSF003F10+ GGCTGAAATGGAGTTTTTGAATGAGAATGCGAAAAAATATATCCGGCAGCTTCCATTATA
                      ____________________________________________________________
consensus GGCTGAAATGGAGTTTTTGAATGAGAATGCGAAAAAATATATCCGGCAGCTTCCATTATA
 
. : . : . : . : . : . :
rJMSF031G01+ TCGTCGCCAGTCATTTACTGAAAGGTTTCCACATGCGCACCCTGGTGCTATTGATCTTGT
rJMFF020I15+ TCGTCGCCAGTCATTTACTGAAAGGTTTCCACATGCGCACCCTGGTGCTATTGATCTTGT
rJMSF007E18+ TCGTCGCCAGTCATTTACTGAAAGGTTTCCACATGCGCACCCTGGTGCTATTGATCTTGT
rJMSF003F10+ TCGTCGCCAGTCATTTACTGAAAGGTTTCCACATGCGCACCCTGGTGCTATTGATCTTGT
                      ____________________________________________________________
consensus TCGTCGCCAGTCATTTACTGAAAGGTTTCCACATGCGCACCCTGGTGCTATTGATCTTGT
 
. : . : . : . : . : . :
rJMSF031G01+ TGAGAAAATGTTGACATTTGATCCCAGGCGAAGAATTACCGTTGAAGGTGCACTTGCGCA
rJMFF020I15+ TGAGAAAATGTTGACATTTGATCCCAGGCGAAGAATTACCGTTGAAGGTGCACTTGCGCA
rJMSF007E18+ TGAGAAAATGTTGACATTTGATCCCAGGCGAAGAATTACCGTTGAAGGTGCACTTGCGCA
rJMSF003F10+ TGAGAAAATGTTGACATTTGATCCCAGGCGAAGAATTACCGTTGAAGGTGCACTTGCGCA
                      ____________________________________________________________
consensus TGAGAAAATGTTGACATTTGATCCCAGGCGAAGAATTACCGTTGAAGGTGCACTTGCGCA
 
. : . : . : . : . : . :
rJMSF031G01+ TCCTTACCTAACATCACTCCACGATATCAGTGACGAGCCAAGTTGCACGACTCCCTTTAA
rJMFF020I15+ TCCTTACCTAACATCACTCCACGATATCAGTGACGAGCCAAGTTGCACGACTCCCTTTAA
rJMSF007E18+ TCCTTACCTAACATCACTCCACGATATCAGTGACGAGCCAAGTTGCACGACTCCCTTTAA
rJMSF003F10+ TCCTTACCTAACATCACTCCACGATATCAGTGACGAGCCAAGTTGCACGACTCCCTTTAA
                      ____________________________________________________________
consensus TCCTTACCTAACATCACTCCACGATATCAGTGACGAGCCAAGTTGCACGACTCCCTTTAA
 
. : . : . : . : . : . :
rJMSF031G01+ CTTTGATTTTGAGCAGCATGCATTGAGCGAGGAGCAGATGAAGGAGCTGATTTACCGAGA
rJMFF020I15+ CTTTGATTTTGAGCAGCATGCATTGAGCGAGGAGCAGATGAAGGAGCTGATTTACCGAGA
rJMSF007E18+ CTTTGATTTTGAGCAGCATGCATTGAGCGAGGAGCAGATGAAGGAGCTGATTTACCGAGA
rJMSF003F10+ CTTTGATTTTGAGCAGCATGCATTGAGCGAGGAGCAGATGAAGGAGCTGATTTACCGAGA
                      ____________________________________________________________
consensus CTTTGATTTTGAGCAGCATGCATTGAGCGAGGAGCAGATGAAGGAGCTGATTTACCGAGA
 
. : . : . : . : . : . :
rJMSF031G01+ GGCCGTTGCTTTCAACCCCGAGTTTGAGCAGCAAATGTGATGAATGAGAGTTGTTGTTAG
rJMFF020I15+ GGCCGTTGCTTTCAACCCCGAGTTTGAGCAGCAAATGTGATGAATGAGAGTTGTTGTTAG
rJMSF007E18+ GGCCGTTGCTTTCAACCCCGAGTTTGAGCAGCAAATGTGATGAATGAGAGTTGTTGTTAG
rJMSF003F10+ GGCCGTTGCTTTCAACCCCGAGTTTGAGCAGCAAATGTGATGAATGAGAGTTGTTGTTAG
                      ____________________________________________________________
consensus GGCCGTTGCTTTCAACCCCGAGTTTGAGCAGCAAATGTGATGAATGAGAGTTGTTGTTAG
 
. : . : . : . : . : . :
rJMSF031G01+ AGTTGTGGCCCTGTGAATTGTGATACTTATCGATTTCATGATTGCTTTATTCATCTGTTA
rJMFF020I15+ AGTTGTGGCCCTGTGAATTGTGATACTTATCGATTTCATGATTGCTTTATTCATCTGTTA
rJMSF007E18+ AGTTGTGGCCCTGTGAATTGTGATACTTATCGATTTCATGATTGCTTTATTCATCTGTTA
rJMSF003F10+ AGTTGTGGCCCTGTGAATTGTGATACTTATCGATTTCATGATTGCTTTATTCATCTGTTA
                      ____________________________________________________________
consensus AGTTGTGGCCCTGTGAATTGTGATACTTATCGATTTCATGATTGCTTTATTCATCTGTTA
 
. : . : . : . : . : . :
rJMSF031G01+ AACCTGTCTGATATTTTCAAC
rJMFF020I15+ AACCTGTCTGATATTTTCAACATTTGATTGTGGGACAATTCGGGTATTCAAAA
rJMSF007E18+ AACCTGTCTGATATTTTCAACATTTGATTGTGGGACAATTCGGGTATTCAAAAATTGTTG
rJMSF003F10+ AACCTGTCTGATATTTTCAACATTTGATTGTGGGACAATTCGGGTATTCAAAAATTGTTG
                      ____________________________________________________________
consensus AACCTGTCTGATATTTTCAACATTTGATTGTGGGACAATTCGGGTATTCAAAAATTGTTG
 
. : . : . : . : . : . :
rJMSF007E18+ TTGTATGAGTGAGGTAGTTACCACTTTGTGTTTAATGCATTGAAGTCCCTAGTAGTTCA
rJMSF003F10+ TTGTATGAGTGAGGTAGTTACCACTTTGTGTTTAATGCATTGAAGTCCCTAGTAGTTCAA
                      ____________________________________________________________
consensus TTGTATGAGTGAGGTAGTTACCACTTTGTGTTTAATGCATTGAAGTCCCTAGTAGTTCAA