Previous Contig 011247:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003C22Sequence368004481 (2)pir|T10237|T102371e-13RNA helicase RH16 - Arabidopsis thaliana>gb:ATCHRIV82_1547452 Arabidopsis thalia771011247 (2)pir|T10237|T102372e-49RNA helicase RH16 - Arabidopsis thaliana>gb:ATCHRIV82_1547452 Arabidopsis thalia
JMSF006D23Sequence353005474 (26)186011247 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF003C22+ TTCAAGAGGTCAAATCTTTATTAGGAGAAAATGATGGCAATGAATCAAATT
                      ____________________________________________________________
consensus TTCAAGAGGTCAAATCTTTATTAGGAGAAAATGATGGCAATGAATCAAATT
 
. : . : . : . : . : . :
rJMSF003C22+ TTATTGCTCCCTTTCCATTGCTCACTAAGAATGCAGTAGAGTCTTTGAGATATAGAGCTG
                      ____________________________________________________________
consensus TTATTGCTCCCTTTCCATTGCTCACTAAGAATGCAGTAGAGTCTTTGAGATATAGAGCTG
 
. : . : . : . : . : . :
rJMSF003C22+ AGGATGTGGCAAGGAGCGTTACCAAAGTTGCTGTAAGAGAATCACGTGCTCAGGATCTGA
                      ____________________________________________________________
consensus AGGATGTGGCAAGGAGCGTTACCAAAGTTGCTGTAAGAGAATCACGTGCTCAGGATCTGA
 
. : . : . : . : . : . :
rJMSF003C22+ GAAATGAAATTCTCAATTCTCAAAAGTTGAAGGCTCATTTTCAAGATAATCCTCGGGATT
                      ____________________________________________________________
consensus GAAATGAAATTCTCAATTCTCAAAAGTTGAAGGCTCATTTTCAAGATAATCCTCGGGATT
 
. : . : . : . : . : . :
rJMSF003C22+ TAGATCTTTTGAAACATGACAAAACCCTTAGTAAGAAGGCTCCTGCTCCACACCTGCGCG
                      ____________________________________________________________
consensus TAGATCTTTTGAAACATGACAAAACCCTTAGTAAGAAGGCTCCTGCTCCACACCTGCGCG
 
. : . : . : . : . : . :
rJMSF003C22+ ATGTGCCTGACTACCTTCTGGACCCAACAACACAGGAAGCTAGCAAGATTGTAAAACTTG
                      ____________________________________________________________
consensus ATGTGCCTGACTACCTTCTGGACCCAACAACACAGGAAGCTAGCAAGATTGTAAAACTTG
 
. : . : . : . : . : . :
rJMSF006D23+ AAGGGGGGTCGAAGGGAAAAT
rJMSF003C22+ CTAGAGCAGCAATGGGAAACGAGAATGCTCCTCGCCGCAAAGGGGGGTTGAAGGGAAAAT
                      ____________________________________________________________
consensus CTAGAGCAGCAATGGGAAACGAGAATGCTCCTCGCCGCAAAGGGGGGTTGAAGGGAAAAT
 
. : . : . : . : . : . :
rJMSF006D23+ TTAAAAGATCTAGNGATCCTCTTAAAACATTCTCGGCANAGGCACCAAAAAGAGCTTCTA
rJMSF003C22+ TTAAAAGATCTAGAGATCCTCTTAAAACATTCTCGGCAGAGGCACCAAAAAGAGCTTCTA
                      ____________________________________________________________
consensus TTAAAAGATCTAGAGATCCTCTTAAAACATTCTCGGCAGAGGCACCAAAAAGAGCTTCTA
 
. : . : . : . : . : . :
rJMSF006D23+ AAGGTGGGATGAAGAGGAAGTCAAAAGATGCAGATGCTGANGCTGGGCNTAAACACAAAN
rJMSF003C22+ AAGGTGGGATGAAGAGGAAGTCAAAAGATGCAGATGCTGATGCTGGGCATAAACACAAAA
                      ____________________________________________________________
consensus AAGGTGGGATGAAGAGGAAGTCAAAAGATGCAGATGCTGATGCTGGGCATAAACACAAAA
 
. : . : . : . : . : . :
rJMSF006D23+ AGNGGTAGAGTGTACTANTNNCATTCAAGNAATNGCANCTGTCCT
rJMSF003C22+ AGAGGTAGAGTGTACTAATATCATTCAAGTAATTGCAACTGTCCTTGACAGCTTATGCAT
                      ____________________________________________________________
consensus AGAGGTAGAGTGTACTAATATCATTCAAGTAATTGCAACTGTCCTTGACAGCTTATGCAT
 
. : . : . : . : . : . :
rJMSF003C22+ ACAAATTTTGTAAACTGTTTAGAATCATAGATTCAAAGTTTTGGTCATTGTAGTTCATTT
                      ____________________________________________________________
consensus ACAAATTTTGTAAACTGTTTAGAATCATAGATTCAAAGTTTTGGTCATTGTAGTTCATTT
 
. : . : . : . : . : . :
rJMSF003C22+ CCAAAATGGGTGCTTTAAATTTTTATTTCTATGAGAGTAATATTATGGGCCCTCCAGCTT
                      ____________________________________________________________
consensus CCAAAATGGGTGCTTTAAATTTTTATTTCTATGAGAGTAATATTATGGGCCCTCCAGCTT
 
. : . : . : . : . : . :
rJMSF003C22+ TATGGTTAGTGATGATTGGTCTAAATGGCCCATTTAGGGTTCTGTAATTGACAATCAATA
                      ____________________________________________________________
consensus TATGGTTAGTGATGATTGGTCTAAATGGCCCATTTAGGGTTCTGTAATTGACAATCAATA