Previous Contig 011246:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010O12Sequence100011246 (8)
JMFF045J14Sequence616011246 (8)gb:AY428798_16058252e-73Citrus junos dicarboxylate/tricarboxylate carrier (dtc) mRNA, complete cds; mito
JMSF003C18Sequence285011246 (8)gb:AY428798_16058256e-15Citrus junos dicarboxylate/tricarboxylate carrier (dtc) mRNA, complete cds; mito723011246 (8)gb:NTA311779_16913413e-63Nicotiana tabacum partial mRNA for mitochondrial dicarboxylate/tricarboxylate ca
JMSF019D06Sequence417011246 (8)gb:AY428798_16058252e-37Citrus junos dicarboxylate/tricarboxylate carrier (dtc) mRNA, complete cds; mito702011246 (8)gb:NTA311779_16913413e-67Nicotiana tabacum partial mRNA for mitochondrial dicarboxylate/tricarboxylate ca
JMSF034P18Sequence625011246 (8)gb:NTA311777_16913391e-75Nicotiana tabacum partial mRNA for mitochondrial dicarboxylate/tricarboxylate ca762011246 (8)gb:NTA311778_16913404e-97Nicotiana tabacum mRNA for mitochondrial dicarboxylate/tricarboxylate carrier (d

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF019D06- GGCTGCCTG
                      ____________________________________________________________
consensus GGCTGCCTG
 
. : . : . : . : . : . :
JMSF003C18- AGTGCTGAGTGCTGAGTGCTGAGTGCTGAGTGCTGGGTGTGTGTGTATATATAACCAA
JMSF019D06- CCAGTGCTGAGTGCTGAGTGCTGAGTGCTGAGTGCTGGGTGTGTGTGTATATATAACCAA
JMFF045J14- AGTGCTGAGTGCTGAGTGCTGAGTGCTGAGTGCTGGGTGTGTGTGTATATATAACCAA
JMSF034P18- AGTGCTGAGTGCTGAGTGCTGAGTGCTGAGTGCTGGGTGTGTGTGTATATATAACCAA
                      ____________________________________________________________
consensus CCAGTGCTGAGTGCTGAGTGCTGAGTGCTGAGTGCTGGGTGTGTGTGTATATATAACCAA
 
. : . : . : . : . : . :
JMSF003C18- TTAAACCAAACCTTTCCTTCCTTCCAACCCTCCAAACCCCATTCTTCCTACCTCGTTATC
JMSF019D06- TTAAACCAAACCTTTCCTTCCTTCCAACCCTCCAAACCCCATTCTTCCTACCTCGTTATC
JMFF045J14- TTAAACCAAACCTTTCCTTCCTTCCAACCCTCCAAACCCCATTCTTCCTACCTCGTTATC
JMSF034P18- TTAAACCAAACCTTTCCTTCCTTCCAACCCTCCAAACCCCATTCTTCCTACCTCGTTATC
                      ____________________________________________________________
consensus TTAAACCAAACCTTTCCTTCCTTCCAACCCTCCAAACCCCATTCTTCCTACCTCGTTATC
 
. : . : . : . : . : . :
JMSF003C18- TGAAGCTCAGAAATCAGACGAAAATGGGAGATCAGAAGCCTAAGCCCGCCGCCGGCATCT
JMSF019D06- TGAAGCTCAGAAATCAGACGAAAATGGGAGATCAGAAGCCTAAGCCCGCCGCCGGCATCT
JMFF045J14- TGAAGCTCAGAAATCAGACGAAAATGGGAGATCAGAAGCCTAAGCCCGCCGCCGGCATCT
JMSF034P18- TGAAGCTCAGAAATCAGACGAAAATGGGAGATCAGAAGCCTAAGCCCGCCGCCGGCATCT
                      ____________________________________________________________
consensus TGAAGCTCAGAAATCAGACGAAAATGGGAGATCAGAAGCCTAAGCCCGCCGCCGGCATCT
 
. : . : . : . : . : . :
JMSF003C18- GGTCCACCGTCAAGCCTTTCGTCAATGGAGGCTGCTCCGGTATGCTCGCCACATGCGTCA
JMSF019D06- GGTCCACCGTCAAGCCTTTCGTCAATGGAGGCTGCTCCGGTATGCTCGCCACATGCGTCA
JMFF045J14- GGTCCACCGTCAAGCCTTTCGTCAATGGAGGCTGCTCCGGTATGCTCGCCACATGCGTCA
JMSF034P18- GGTCCACCGTCAAGCCTTTCGTCAATGGAGGCTGCTCCGGTATGCTCGCCACATGCGTCA
                      ____________________________________________________________
consensus GGTCCACCGTCAAGCCTTTCGTCAATGGAGGCTGCTCCGGTATGCTCGCCACATGCGTCA
 
. : . : . : . : . : . :
JMSF003C18- TCCAGCCTATTGACATGATCAAGGTGAGAATACAACTGGGCCA
JMSF019D06- TCCAGCCTATTGACATGATCAAGGTGAGAATACAACTGGGCCAGGGATCAGCAGCAGATG
JMFF045J14- TCCAGCCTATTGACATGATCAAGGTGAGAATACAACTGGGCCAGGGATCAGCAGCAGATG
JMSF034P18- TCCAGCCTATTGACATGATCAAGGTGAGAATACAACTGGGCCAGGGATCAGCAGCAGATG
                      ____________________________________________________________
consensus TCCAGCCTATTGACATGATCAAGGTGAGAATACAACTGGGCCAGGGATCAGCAGCAGATG
 
. : . : . : . : . : . :
JMSF019D06- TGACCAAGAACATGCTTAAAAATGAGGGTTTTGGTGCCTTTTACAAGGGTTTGTCTGCGG
JMFF045J14- TGACCAAGAACATGCTTAAAAATGAGGGTTTTGGTGCCTTTTACAAGGGTTTGTCTGCGG
JMSF034P18- TGACCAAGAACATGCTTAAAAATGAGGGTTTTGGTGCCTTTTACAAGGGTTTGTCTGCGG
                      ____________________________________________________________
consensus TGACCAAGAACATGCTTAAAAATGAGGGTTTTGGTGCCTTTTACAAGGGTTTGTCTGCGG
 
. : . : . : . : . : . :
JMSF019D06- GGCTGCTTAGACAAGCTACATATACAACTGCTAGACTGGGATCATTCA
JMFF045J14- GGCTGCTTAGACAAGCTACATATACAACTGCTAGACTGGGATCATTCAGAATTTTGACGA
JMSF034P18- GGCTGCTTAGACAAGCTACATATACAACTGCTAGACTGGGATCATTCAGAATTTTGACGA
                      ____________________________________________________________
consensus GGCTGCTTAGACAAGCTACATATACAACTGCTAGACTGGGATCATTCAGAATTTTGACGA
 
. : . : . : . : . : . :
JMFF045J14- ACAAGGCTATTGAAGCAAATGATGGGAAGCCCCTACCTTTGTATCAGAAGGCTTTGTGTG
JMSF034P18- ACAAGGCTATTGAAGCAAATGATGGGAAGCCCCTACCTTTGTATCAGAAGGCTTTGTGTG
rJMSF034P18+ GATGGGAAGCCCCTACCTTTGTATCAGAAGGCTTTGTGTG
                      ____________________________________________________________
consensus ACAAGGCTATTGAAGCAAATGATGGGAAGCCCCTACCTTTGTATCAGAAGGCTTTGTGTG
 
. : . : . : . : . : . :
JMFF045J14- GGCTGACTGCTGGTGCAATTGGAGCATGTGTTGGCAGTCCAGCTGATTTATCACTCATTC
JMSF034P18- GGCTGACTGCTGGTGCAATTGGAGCATGTGTTGGCAGTCCAGCTGATTTATCACTCATTC
rJMSF034P18+ GGCTGACTGCTGGTGCAATTGGAGCATGTGTTGGCAGTCCAGCTGATTTATCACTCATTC
                      ____________________________________________________________
consensus GGCTGACTGCTGGTGCAATTGGAGCATGTGTTGGCAGTCCAGCTGATTTATCACTCATTC
 
. : . : . : . : . : . :
JMFF045J14- GTATGCAGGCTGATGCCACCTTACCTGCTGCCNCACGGCGTAACTACACAAATGCCTTTA
JMSF034P18- GTATGCAGGCTGATGCCACCTTACCTGCTGCCCAACGGCGTAACTACACAAATGCCTTTA
rJMSF034P18+ GTATGCAGGCTGATGCCACCTTACCTGCTGCCCAACGGCGTAACTACACAAATGCCTTTA
rJMSF019D06+ CCTGCTGCCCAACGGNGTAACTACACAAATGCCTTTA
                      ____________________________________________________________
consensus GTATGCAGGCTGATGCCACCTTACCTGCTGCCCAACGGCGTAACTACACAAATGCCTTTA
 
. : . : . : . : . : . :
JMFF045J14- ATGCACTTT
JMSF034P18- ATGCACTTTCTCGCATTGTTGCTGAT
rJMSF034P18+ ATGCACTTTCTCGCATTGTTGCTGATGAAGGAGTTTTAGCCCTCTGGAAGGGTGCTGGGC
rJMSF019D06+ ATGCACTTTCTCGCATTGTTGCTGATGAAGGAGTTTTAGCCCTCTGGAAGGGTGCTGGGC
rJMSF003C18+ CGCATTGTTGCTGATGAAGGAGTTTTAGCCCTCTGGAAGGGTGCTGGGC
                      ____________________________________________________________
consensus ATGCACTTTCTCGCATTGTTGCTGATGAAGGAGTTTTAGCCCTCTGGAAGGGTGCTGGGC
 
. : . : . : . : . : . :
rJMSF034P18+ CAACTGTGGTGAGAGCAATGGCACTGAACATGGGGATGCTTGCCTCTTATGATCAAAGTG
rJMSF019D06+ CAACTGTGGTGAGAGCAATGGCACTGAACATGGGGATGCTTGCCTCTTATGATCAAAGTG
rJMSF003C18+ CAACTGTGGTGAGAGCAATGGCACTGAACATGGGGATGCTTGCCTCTTATGATCAAAGTG
                      ____________________________________________________________
consensus CAACTGTGGTGAGAGCAATGGCACTGAACATGGGGATGCTTGCCTCTTATGATCAAAGTG
 
. : . : . : . : . : . :
rJMSF034P18+ TGGAGTTCTTTAGGGATTCCCTTGGTATGGGTGAGGCTGCTACTGTCGTAGGTGCCAGTA
rJMSF019D06+ TGGAGTTCTTTAGGGATTCCCNTGGTATGGGTGAGGCTGCTACTGTNGTAGGTGCCNGTA
rJMSF003C18+ TGGAGTTCTTTAGGGATTCCCTTGGTATGGGTGAGGCTGCTACTGTCGTAGGTGCCAGTA
                      ____________________________________________________________
consensus TGGAGTTCTTTAGGGATTCCCTTGGTATGGGTGAGGCTGCTACTGTCGTAGGTGCCAGTA
 
. : . : . : . : . : . :
rJMSF034P18+ GTGTTTCTGGGTTCTTTGCTGCTGCTTGCAGTTTACCATTTGACTTTGTCAAAACACAAA
rJMSF019D06+ GTGTTTNTGGGTTCTTTGCTGCTGCTTGCAGTTTACCNTTTGACTTTGTCAAAACNCAAA
rJMSF003C18+ GTGTTTCTGGGTTCTTTGCTGCTGCTTGCAGTTTACCATTTGACTTTGTCAAAACNCAAA
                      ____________________________________________________________
consensus GTGTTTCTGGGTTCTTTGCTGCTGCTTGCAGTTTACCATTTGACTTTGTCAAAACACAAA
 
. : . : . : . : . : . :
rJMSF034P18+ TACAGAAGATGCAACCAGATGCTCAAGGAAAATACCCATATACTGGTTCTTTTGACTGCG
rJMSF019D06+ TACNGAAGATGCAACCNGATGCTCAAGGAAAATACCCATATACTGGTTNTTTTGACTGCG
rJMSF003C18+ TACNGAAGATGCAACCNGATGCTCAAGGAAAATACCCATATACTGGTTCTTTTGACTGCG
                      ____________________________________________________________
consensus TACAGAAGATGCAACCAGATGCTCAAGGAAAATACCCATATACTGGTTCTTTTGACTGCG
 
. : . : . : . : . : . :
rJMSF034P18+ CCATGAAAACATTGAAGGCAGGAGGGCCTTTGAAATTTTACACCGGATTTCCAGTGTATT
rJMSF019D06+ CCNTGAAAACNTTGAAGGCNGGAGGGCCTTTGAAATTTTACNCCGGATTTCCNGTGTATT
rJMSF003C18+ CCATGAAAACNTTGAAGGCAGGAGGGCCTTTGAAATTTTACNCCGGATTTCCAGTGTATT
                      ____________________________________________________________
consensus CCATGAAAACATTGAAGGCAGGAGGGCCTTTGAAATTTTACACCGGATTTCCAGTGTATT
 
. : . : . : . : . : . :
rJMSF034P18+ GTGTTAGGATTGCTCCCCACGTCATGATGACATGGATATTCCTTAACCAAATCCAAAAGA
rJMSF019D06+ GTGTTAGGATTGCTCCCCNCGTCATGATGACNTGGATATTCCTTAACCAAATCCNAAAGA
rJMFF010O12+ ATGATGACANGGATATTCCNTAACCAAATCCNAAAGA
rJMSF003C18+ GTGTTAGGATTGCTCCCCNCGTCATGATGACATGGATATTCCTTAACCAAATCCAAAAGA
                      ____________________________________________________________
consensus GTGTTAGGATTGCTCCCCACGTCATGATGACATGGATATTCCTTAACCAAATCCAAAAGA
 
. : . : . : . : . : . :
rJMSF034P18+ TTGAGAAGGATCTGGGATTGTAGTAGGTTCACATGACAAAGAAAGATCACACAAGTTGTG
rJMSF019D06+ TTGAGAAGGATNTGGGATTGTAGTAGGTTCNCNTGACAAAGAAAGATCNCNCNAGTTGTG
rJMFF010O12+ TTGAGAAGGNTTTGGGATTGTAGTAGGTTCACANNACAAAGAAAGATCACNCAANTTGTG
rJMSF003C18+ TTGAGAAGGATCTGGGATTGTAGTAGGTTCACATGACAAAGAAAGATCACNCAAGTTGTG
                      ____________________________________________________________
consensus TTGAGAAGGATCTGGGATTGTAGTAGGTTCACATGACAAAGAAAGATCACACAAGTTGTG
 
. : . : . : . : . : . :
rJMSF034P18+ CTCTACTGCAATATTATCTTATTTGTACTAGTTCTACTTCATGCTTTTAACCCAACTGAG
rJMSF019D06+ CTNTACTGCAATATTATNTTATTTGTACTAGTTNTACTTCNTGCTTTTAACCCAACTGAG
rJMFF010O12+ CTC
rJMSF003C18+ CTCTACTGCAATATTATCTTATTTGTACTAGTTNTACTTCATGCTTTTAACCCAACTGAG
                      ____________________________________________________________
consensus CTCTACTGCAATATTATCTTATTTGTACTAGTTCTACTTCATGCTTTTAACCCAACTGAG
 
. : . : . : . : . : . :
rJMSF034P18+ GCTCTCCATATATATCTCTATTGGTTAGAGCAGGAATTTGGAGTTCCTGAGATT
rJMSF019D06+ GCTCTCCNTATATATCTCTATTGGTTAGAGCNGGAATTTGGAGTTCCTGAGATTTCTTTT
rJMSF003C18+ GCTCTCCATATATATCTCTATTGGTTAGAGCNGGAATTTGGAGTTCCTGAGATTTCTTTT
                      ____________________________________________________________
consensus GCTCTCCATATATATCTCTATTGGTTAGAGCAGGAATTTGGAGTTCCTGAGATTTCTTTT
 
. : . : . : . : . : . :
rJMSF019D06+ GAACTACTTTTTTGAGAGGAAGTTTGCTGAAATTTTCCCTGAGAATTTTGTCAAAATAAT
rJMSF003C18+ GAACTACTTTTTTGAGAGGAAGTTTGCTGAAATTTTCCCTGAGAATTTTGTCAAAATAAT
                      ____________________________________________________________
consensus GAACTACTTTTTTGAGAGGAAGTTTGCTGAAATTTTCCCTGAGAATTTTGTCAAAATAAT
 
. : . : . : . : . : . :
rJMSF003C18+ GGATGTACTGTGTACTCAGCAATACGAATTGCATTTTTTTTTTCCTGCACCAAAATCTTA
                      ____________________________________________________________
consensus GGATGTACTGTGTACTCAGCAATACGAATTGCATTTTTTTTTTCCTGCACCAAAATCTTA