Previous Contig 011245:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003C13Sequence337011245 (2)gb:AY048972_15617982e-32Nicotiana tabacum RNA-binding protein precursor, mRNA, complete cds; nuclear gen748011245 (2)gb:AY048972_15617988e-18Nicotiana tabacum RNA-binding protein precursor, mRNA, complete cds; nuclear gen

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF003C13- GAGAAGCTCTGAGAAGCCTGAGCTGTGGTGGTTAAACGAGAAGG
                      ____________________________________________________________
consensus GAGAAGCTCTGAGAAGCCTGAGCTGTGGTGGTTAAACGAGAAGG
 
. : . : . : . : . : . :
JMSF003C13- GTTTATCGATCCGCCGAAGGAATGGCTTTTGCAAATAGAATTGGAAATGTGCTCAAACAG
                      ____________________________________________________________
consensus GTTTATCGATCCGCCGAAGGAATGGCTTTTGCAAATAGAATTGGAAATGTGCTCAAACAG
 
. : . : . : . : . : . :
JMSF003C13- GCAGTTAGCAGGCACATGAATCCTGAGTTATCTCACTCAAACTCATCCCTGTACCAGGCA
                      ____________________________________________________________
consensus GCAGTTAGCAGGCACATGAATCCTGAGTTATCTCACTCAAACTCATCCCTGTACCAGGCA
 
. : . : . : . : . : . :
JMSF003C13- TATAGAAGCATGTCGTCTTCAAAGCTTTTTGTTGGAGGCCTTTCTTATGGGACTGATGAA
                      ____________________________________________________________
consensus TATAGAAGCATGTCGTCTTCAAAGCTTTTTGTTGGAGGCCTTTCTTATGGGACTGATGAA
 
. : . : . : . : . : . :
JMSF003C13- ACAAGTTTGAAGGAAACATTTGACCAGTTTGGTACTGTGCTTGAAGCACGGATTATTATG
rJMSF003C13+ TACTGTGCTTGNAGCACGGATTATTATG
                      ____________________________________________________________
consensus ACAAGTTTGAAGGAAACATTTGACCAGTTTGGTACTGTGCTTGAAGCACGGATTATTATG
 
. : . : . : . : . : . :
JMSF003C13- GACCGTGATACTGGAAGATCCAGANGCTTTGGCTTTGTTAGTTTTTCAACAAC
rJMSF003C13+ GACCGTGATACTGGAAGATCCAGAGGCTTTGGCTTTGTTAGTTTTTCAACAACTGATTGT
                      ____________________________________________________________
consensus GACCGTGATACTGGAAGATCCAGAGGCTTTGGCTTTGTTAGTTTTTCAACAACTGATTGT
 
. : . : . : . : . : . :
rJMSF003C13+ GCAACCAGTGCCATGCAGGCCATGGATGGACAGGATCTTCATGGCCGACGGATTAGGGTG
                      ____________________________________________________________
consensus GCAACCAGTGCCATGCAGGCCATGGATGGACAGGATCTTCATGGCCGACGGATTAGGGTG
 
. : . : . : . : . : . :
rJMSF003C13+ AACTATGCAACTGAGAAGCCTCGTGGTGGATTTGGTGGTGGAGGATATGGAAACAATAGT
                      ____________________________________________________________
consensus AACTATGCAACTGAGAAGCCTCGTGGTGGATTTGGTGGTGGAGGATATGGAAACAATAGT
 
. : . : . : . : . : . :
rJMSF003C13+ TATGGAAGTGGAGGTGGGAACTATGGCAGAGGGGATGGATATGGAGGTGGTAGCTATGGC
                      ____________________________________________________________
consensus TATGGAAGTGGAGGTGGGAACTATGGCAGAGGGGATGGATATGGAGGTGGTAGCTATGGC
 
. : . : . : . : . : . :
rJMSF003C13+ AGTGGAGCGGGTGGATATGGTGGTGGTGGTAACTATGGCAGCAGTGGTGGTGGTAACTAC
                      ____________________________________________________________
consensus AGTGGAGCGGGTGGATATGGTGGTGGTGGTAACTATGGCAGCAGTGGTGGTGGTAACTAC
 
. : . : . : . : . : . :
rJMSF003C13+ AACAGCGTTGCGGGTGGATATGGTGGAGGTGGTAACTATGGCGGCAGTGGTGGGTTTGGT
                      ____________________________________________________________
consensus AACAGCGTTGCGGGTGGATATGGTGGAGGTGGTAACTATGGCGGCAGTGGTGGGTTTGGT
 
. : . : . : . : . : . :
rJMSF003C13+ AGTGACTATGGGAGCAATGTCGGCTATAACAGCAGTTATGCCACTGAAGAGAGAAACTTT
                      ____________________________________________________________
consensus AGTGACTATGGGAGCAATGTCGGCTATAACAGCAGTTATGCCACTGAAGAGAGAAACTTT
 
. : . : . : . : . : . :
rJMSF003C13+ GATGGTGGGAATAGTGGTATTGGCAATAATGGTAACAGTTATGCCAACACCGGATTTGAT
                      ____________________________________________________________
consensus GATGGTGGGAATAGTGGTATTGGCAATAATGGTAACAGTTATGCCAACACCGGATTTGAT
 
. : . : . : . : . : . :
rJMSF003C13+ AGGACAGCAGGTTATGGTGCAGGCCAGCAACAGCTGAACACAAATCAAGAGATACCCGAG
                      ____________________________________________________________
consensus AGGACAGCAGGTTATGGTGCAGGCCAGCAACAGCTGAACACAAATCAAGAGATACCCGAG
 
. : . : . : . : . : . :
rJMSF003C13+ CCTGTTGCTGGAGATTTCACCCATGACCCATTGGACGGGAATTACAGGGATGACGACAAC
                      ____________________________________________________________
consensus CCTGTTGCTGGAGATTTCACCCATGACCCATTGGACGGGAATTACAGGGATGACGACAAC
 
. : . : . : . : . : . :
rJMSF003C13+ GAGCCAGATGGTTATGCCAACAAAAGCGGCTGAAGAAATCTTTCATAGATGATATACTGT
                      ____________________________________________________________
consensus GAGCCAGATGGTTATGCCAACAAAAGCGGCTGAAGAAATCTTTCATAGATGATATACTGT
 
. : . : . : . : . : . :
rJMSF003C13+ GTTGAGCTTGCCTAGGAACAAAACATAATAAGTCACTTCTTTTGGTGTTGCTATGCACAT
                      ____________________________________________________________
consensus GTTGAGCTTGCCTAGGAACAAAACATAATAAGTCACTTCTTTTGGTGTTGCTATGCACAT