Previous Contig 011241:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003A22Sequence296011241 (4)gb:AY088820_15738300.018Arabidopsis thaliana clone 96179 mRNA, complete sequence.648011241 (4)gb:AY088820_15738302e-04Arabidopsis thaliana clone 96179 mRNA, complete sequence.
JMSF028A04Sequence449011241 (4)gb:AY088820_15738300.004Arabidopsis thaliana clone 96179 mRNA, complete sequence.645011241 (4)gb:AY088820_15738302e-04Arabidopsis thaliana clone 96179 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF003A22- GGGGAACTGTCATCTTTAAGCTAAAATTTCAGGGGAAGACGACAGAGC
rJMSF028A04+ GGGAACTGTCATCTTTAAGCTAAAATTTCAGGGGAAGACGACAGAGC
JMSF028A04- GGGAACTGTCATCTTTAAGCTAAAATTTCAGGGGAAGACGACAGAGC
rJMSF003A22+ GGGAACTGTCATCTTTAAGCTAAAATTTCAGGGGAAGACGACAGAGC
                      ____________________________________________________________
consensus GGGGAACTGTCATCTTTAAGCTAAAATTTCAGGGGAAGACGACAGAGC
 
. : . : . : . : . : . :
JMSF003A22- TCAAATTCTAGATGGACCGTCACTGCTCAAACTACGCCGTCGTATTGTTTGTAATTCTGG
rJMSF028A04+ TCAAATTCTAGATGGACCGTCACTGCTCAAACTACGCCGTCGTATTGTTTGTAATTCTGG
JMSF028A04- TCAAATTCTAGATGGACCGTCACTGCTCAAACTACGCCGTCGTATTGTTTGTAATTCTGG
rJMSF003A22+ TCAAATTCTAGATGGACCGTCACTGCTCAAACTACGCCGTCGTATTGTTTGTAATTCTGG
                      ____________________________________________________________
consensus TCAAATTCTAGATGGACCGTCACTGCTCAAACTACGCCGTCGTATTGTTTGTAATTCTGG
 
. : . : . : . : . : . :
JMSF003A22- TTTCCCTGAATATCCTCAACCCGGCAGCCGACGGGAGAGAGCTCCGGCCGTCGGAGCACG
rJMSF028A04+ TTTCCCTGAATATCCTCAACCCGGCAGCCGACGGGAGAGAGCTCCGGCCGTCGGAGCACG
JMSF028A04- TTTCCCTGAATATCCTCAACCCGGCAGCCGACGGGAGAGAGCTCCGGCCGTCGGAGCACG
rJMSF003A22+ TTTCCCTGAATATCCTCAACCCGGCAGCCGACGGGAGAGAGCTCCGGCCGTCGGAGCACG
                      ____________________________________________________________
consensus TTTCCCTGAATATCCTCAACCCGGCAGCCGACGGGAGAGAGCTCCGGCCGTCGGAGCACG
 
. : . : . : . : . : . :
JMSF003A22- GCTTGGGGAATCAGGACTCATCCTCGGGCAACAAGTCGGAGATTCTCACCTTCTTCGGTG
rJMSF028A04+ GCTTGGGGAATCAGGACTCATCCTCGGGCAACAAGTCGGAGATTCTCACCTTCTTCGGTG
JMSF028A04- GCTTGGGGAATCAGGACTCATCCTCGGGCAACAAGTCGGAGATTCTCACCTTCTTCGGTG
rJMSF003A22+ GCTTGGGGAATCAGGACTCATCCTCGGGCAACAAGTCGGAGATTCTCACCTTCTTCGGTG
                      ____________________________________________________________
consensus GCTTGGGGAATCAGGACTCATCCTCGGGCAACAAGTCGGAGATTCTCACCTTCTTCGGTG
 
. : . : . : . : . : . :
JMSF003A22- GTTCGCCGGAGTCTTCGGAGCTGCCGGAGGCGAGGAATTTTACGGCCTCTTTGTGGAACG
rJMSF028A04+ GTTCGCCGGAGTCTTCGGAGCTGCCGGAGGCGAGGAATTTTACGGCCTCTTTGTGGAACG
JMSF028A04- GTTCGCCGGAGTCTTCGGAGCTGCCGGAGGCGAGGAATTTTACGGCCTCTTTGTGGAACG
rJMSF003A22+ GTTCGCCGGAGTCTTCGGAGCTGCCGGAGGCGAGGAATTTTACGGCCTCTTTGTGGAACG
                      ____________________________________________________________
consensus GTTCGCCGGAGTCTTCGGAGCTGCCGGAGGCGAGGAATTTTACGGCCTCTTTGTGGAACG
 
. : . : . : . : . : . :
JMSF003A22- GCGTC
rJMSF028A04+ GCGTCGGCGGCGGTGGCGGCAGAAGTATTGGAGGGAGTTCACGTGAGGGGAAGAAGGATG
JMSF028A04- GCGTCGGCGGCGGTGGCGGCAGAAGTATTGGAGGGAGTTCACGTGAGGGGAANAAGGATG
rJMSF003A22+ GCGTCGGCGGCGGTGGCGGCAGAAGTATTGGAGGGAGTTCACGTGAGGGGAAGAAGGATG
                      ____________________________________________________________
consensus GCGTCGGCGGCGGTGGCGGCAGAAGTATTGGAGGGAGTTCACGTGAGGGGAAGAAGGATG
 
. : . : . : . : . : . :
rJMSF028A04+ ACGCGATAAGAGAGGTGCTGTTTGTGGCCAGCATGGTGTGTGGACTAACCGGCGTCGTTT
JMSF028A04- ACGCGATAANAGAGGTGCTGTTTGTGGCCANCATGGTGTGTGNACTAACCG
rJMSF003A22+ ACGCGATAAGAGAGGTGCTGTTTGTGGCCAGCATGGTGTGTGGACTAACCGGCGTCGTTT
                      ____________________________________________________________
consensus ACGCGATAAGAGAGGTGCTGTTTGTGGCCAGCATGGTGTGTGGACTAACCGGCGTCGTTT
 
. : . : . : . : . : . :
rJMSF028A04+ TGGTCGTCGCCTCCGCGTTCCTTCTCGTTTTCCGGCTCCGGAAACGGAAAAGCGAGACGA
rJMSF003A22+ TGGTCGTCGCCTCCGCGTTCCTTCTCGTTTTCCGGCTCCGGAAACGGAAAAGCGAGACGA
                      ____________________________________________________________
consensus TGGTCGTCGCCTCCGCGTTCCTTCTCGTTTTCCGGCTCCGGAAACGGAAAAGCGAGACGA
 
. : . : . : . : . : . :
rJMSF028A04+ CGTCGTTGTCAGAAGCTAACGTCGCCCAGAAGTAACTGGATGTGTACCGCGTATACAGTA
rJMSF003A22+ CGTCGTTGTCAGAAGCTAACGTCGCCCAGAAGTAACTGGATGTGTACCGCGTATACAGTA
                      ____________________________________________________________
consensus CGTCGTTGTCAGAAGCTAACGTCGCCCAGAAGTAACTGGATGTGTACCGCGTATACAGTA
 
. : . : . : . : . : . :
rJMSF028A04+ GTGCGTTCCATCCAAATTCCAAAAGCAAAAAAGTGGATATCTCTCATCTTTTTCTTTTTA
rJMSF003A22+ GTGCGTTCCATCCAAATTCCAAAAGCAAAAAAGTGGATATCTCTCATCTTTTTCTTTTTA
                      ____________________________________________________________
consensus GTGCGTTCCATCCAAATTCCAAAAGCAAAAAAGTGGATATCTCTCATCTTTTTCTTTTTA
 
. : . : . : . : . : . :
rJMSF028A04+ TTCCCATTTTTGTTATTATTACTTTCTTAACTTGTAAGTTTTAACCCTCATATTATCC
rJMSF003A22+ TTCCCATTTTTGTTATTATTACTTTCTTAACTTGTAAGTTTTAACCCTCATATTATCCAT
                      ____________________________________________________________
consensus TTCCCATTTTTGTTATTATTACTTTCTTAACTTGTAAGTTTTAACCCTCATATTATCCAT