Previous Contig 011236:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002P01Sequence341005867 (6)gb:AB109388_15268421e-23Nicotiana tabacum NtPDR1 gene for PDR-type ABC transporter 1, complete cds.687011236 (3)gb:AB109389_15268431e-70Nicotiana tabacum NtPDR2 mRNA for PDR-type ABC transporter 2, partial cds.
JMSF008D03Sequence286018563gb:AB109389_15268434e-42Nicotiana tabacum NtPDR2 mRNA for PDR-type ABC transporter 2, partial cds.774011236 (3)gb:AB109389_15268432e-85Nicotiana tabacum NtPDR2 mRNA for PDR-type ABC transporter 2, partial cds.
JMSF020A12Sequence653005867 (6)gb:AB109388_15268425e-62Nicotiana tabacum NtPDR1 gene for PDR-type ABC transporter 1, complete cds.750011236 (3)gb:AB109389_15268436e-82Nicotiana tabacum NtPDR2 mRNA for PDR-type ABC transporter 2, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF020A12+ TTCAACCTGTGGTGTCGGTGGAACGGACTGTGT
rJMSF008D03+ TGGGTGTTCAAAACTCGGCATCTGTTCAACCTGTGGTGTCGGTGGAACGGACTGTGT
                      ____________________________________________________________
consensus TGGGTGTTCAAAACTCGGCATCTGTTCAACCTGTGGTGTCGGTGGAACGGACTGTGT
 
. : . : . : . : . : . :
rJMSF020A12+ TCTACCGGGAAAAAGCCGCCGGAATGTTTTCTGCCTTACCATATGCCTTTGCCCAGGTGG
rJMSF008D03+ TCTACCGGGAAAAAGCCGCCGGAATGTTTTCTGCCTTACCATATGCCTTTGCCCAGGTGG
rJMSF002P01+ CCTTACCATATGCCTTTGCCCAGGTGG
                      ____________________________________________________________
consensus TCTACCGGGAAAAAGCCGCCGGAATGTTTTCTGCCTTACCATATGCCTTTGCCCAGGTGG
 
. : . : . : . : . : . :
rJMSF020A12+ CGATTGAGATCCCTTACGTGTTTGCCCAATCTGCAGTTTACGGTTTGATCGTTTATGCGA
rJMSF008D03+ CGATTGAGATCCCTTACGTGTTTGCCCAATCTGCAGTTTACGGTTTGATCGTTTATGCGA
rJMSF002P01+ CGATTGAGATCCCTTACGTGTTTGCCCAATCTGCAGTTTACGGTTTGATCGTTTATGCGA
                      ____________________________________________________________
consensus CGATTGAGATCCCTTACGTGTTTGCCCAATCTGCAGTTTACGGTTTGATCGTTTATGCGA
 
. : . : . : . : . : . :
rJMSF020A12+ TGATCGGATTCGAATGGGACGCCGGAAAATTCTTCTGGTACTTGTTCGTCATGTATATGA
rJMSF008D03+ TGATCGGATTCGAATGGGACGCCGGAAAATTCTTCTGGTACTTGTTCGTCATGTATATGA
rJMSF002P01+ TGATCGGATTCGAATGGGACGCCGGAAAATTCTTCTGGTACTTGTTCGTCATGTATATGA
                      ____________________________________________________________
consensus TGATCGGATTCGAATGGGACGCCGGAAAATTCTTCTGGTACTTGTTCGTCATGTATATGA
 
. : . : . : . : . : . :
rJMSF020A12+ CCTTGTTATACTTCACTTATTACGGCATGATGTCTGTGGCCATCACCCCCAACCAAAACG
rJMSF008D03+ CCTTGTTATACTTCACTTATTACGGCATGATGTCTGTGGCCATCACCCCCAACCAAAACG
rJMSF002P01+ CCTTGTTATACTTCACTTATTACGGCATGATGTCTGTGGCCATCACCCCCAACCAAAACG
                      ____________________________________________________________
consensus CCTTGTTATACTTCACTTATTACGGCATGATGTCTGTGGCCATCACCCCCAACCAAAACG
 
. : . : . : . : . : . :
rJMSF020A12+ TCGCTTCCATTGTCTCTGCTTTCTTCTATGGAATCTGGAACGTCTTCTCCGGCTTCATGA
rJMSF008D03+ TCGCTTCCATTGTCTCTGCTTTCTTCTATGGAATCTGGAACGTCTTCTCCGGCTTCATGA
rJMSF002P01+ TCGCTTCCATTGTCTCTGCTTTCTTCTATGGAATCTGGAACGTCTTCTCCGGCTTCATGA
                      ____________________________________________________________
consensus TCGCTTCCATTGTCTCTGCTTTCTTCTATGGAATCTGGAACGTCTTCTCCGGCTTCATGA
 
. : . : . : . : . : . :
rJMSF020A12+ TCCCAAGACCTAGGATGCCGATCTGGTGGAGATGGTATTTCTGGGCATGCCCAGTTTCAT
rJMSF008D03+ TCCCAAGACCTAGGATGCCGATCTGGTGGAGATGGTATTTCTGGGCATGCCCAGTTTCAT
rJMSF002P01+ TCCCAAGACCTAGGATGCCGATCTGGTGGAGATGGTATTTCTGGGCATGCCCAGTTTCAT
                      ____________________________________________________________
consensus TCCCAAGACCTAGGATGCCGATCTGGTGGAGATGGTATTTCTGGGCATGCCCAGTTTCAT
 
. : . : . : . : . : . :
rJMSF020A12+ GGACTTTGTACGGTTTGGTTGCCTCGCAATTTGGAGACCTGGAGAGTCGAGTCATCGACG
rJMSF008D03+ GGACTTTGTACGGTTTGGTTGCCTCGCAATTTGGAGACCTGGAGAGTCGAGTCATCGACG
rJMSF002P01+ GGACTTTGTACGGTTTGGTTGCCTCGCAATTTGGAGACCTGGAGAGTCGAGTCATCGACG
                      ____________________________________________________________
consensus GGACTTTGTACGGTTTGGTTGCCTCGCAATTTGGAGACCTGGAGAGTCGAGTCATCGACG
 
. : . : . : . : . : . :
rJMSF020A12+ CCGACCAAACTGTGAAGGAGCTCTTGGATGATTTCTTGGGGTTCAAACATAGTTTCCTGG
rJMSF008D03+ CCGACCAAACTGTGAAGGAGCTCTTGGATGATTTCTTGGGGTTCAAACATAGTTTCCTGG
rJMSF002P01+ CCGACCAAACTGTGAAGGAGCTCTTGGATGATTTCTTGGGGTTCAAACATAGTTTCCTGG
                      ____________________________________________________________
consensus CCGACCAAACTGTGAAGGAGCTCTTGGATGATTTCTTGGGGTTCAAACATAGTTTCCTGG
 
. : . : . : . : . : . :
rJMSF020A12+ GAGTGGTGGCCGCCGTGCTGGTCGTTTTCCCGGTTATGTTCGCCGTCACCTTCGCGTACG
rJMSF008D03+ GAGTGGTGGCCGCCGTGCTGGTCGTTTTCCCGGTTATGTTCGCCGTCACCTTCGCGTACG
rJMSF002P01+ GAGTGGTGGCCGCCGTGCTGGTCGTTTTCCCGGTTATGTTCGCCGTCACCTTCGCGTACG
                      ____________________________________________________________
consensus GAGTGGTGGCCGCCGTGCTGGTCGTTTTCCCGGTTATGTTCGCCGTCACCTTCGCGTACG
 
. : . : . : . : . : . :
rJMSF020A12+ CCATCAAGGTGTTGAACTTCCAGAAGAGATAAAAACCTGCGCCTCAATTATATTATAGTT
rJMSF008D03+ CCATCAAGGTGTTGAACTTCCAGAAGAGATAAAAACCTGCGCCTCAATTATATTATAGTT
rJMSF002P01+ CCATCAAGGTGTTGAACTTCCAGAAGAGATAAAAACCTGCGCCTCAATTATATTATAGTT
                      ____________________________________________________________
consensus CCATCAAGGTGTTGAACTTCCAGAAGAGATAAAAACCTGCGCCTCAATTATATTATAGTT
 
. : . : . : . : . : . :
rJMSF020A12+ GTACTATGTATATGATACGCCTTCATCCTTAAGTTTATTTTTAATTTGCTCTTTATTATG
rJMSF008D03+ GTACTATGTATATGATACGCCTTCACCCTTAAGTTTATTTTTAATTTGCTCTTTATTATG
rJMSF002P01+ GTACTATGTATATGATACGCCTTCATCCTTAAGTTTATTTTTAANTTGCTCTTTATNATG
                      ____________________________________________________________
consensus GTACTATGTATATGATACGCCTTCATCCTTAAGTTTATTTTTAATTTGCTCTTTATTATG
 
. : . : . : . : . : . :
rJMSF020A12+ TAATATTTGACTTTGAGAATTTGTTTCTACATTCTTTTTTGTCCAATTAAATGTG
rJMSF008D03+ TAATATTTGACTTTGAGAATTTGTTTCTACATTCTTTTTTGTCCAATTAAATGTG
rJMSF002P01+ TAATANTTGACTNTGAGAANTTGNTTNTACATTCTTTNTTGNCCAATTAAATGTGNGTAA
                      ____________________________________________________________
consensus TAATATTTGACTTTGAGAATTTGTTTCTACATTCTTTTTTGTCCAATTAAATGTGNGTAA