Previous Contig 011235:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030O19Sequence437001406 (2)657011235 (3)gb:BT002894_16364843e-74Arabidopsis thaliana clone RAFL15-20-M04 (R20457) putative short chain alcohol d
JMSF002E18Sequence448011235 (3)gb:AB104856_15265483e-41Daucus carota DcADH mRNA for short chain alcohol dehydrogenase-like protein, com
JMSF002O20Sequence255018291654011235 (3)gb:BT002894_16364845e-19Arabidopsis thaliana clone RAFL15-20-M04 (R20457) putative short chain alcohol d

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF002E18- GGGCAACAATTATCCACTTCTCAGCT
                      ____________________________________________________________
consensus GGGCAACAATTATCCACTTCTCAGCT
 
. : . : . : . : . : . :
JMSF002E18- CTCACTGCGAGAGAATCAGTATTTCAATGGCGAAGACCGGAGAGGGCAGCAGATCAAGAT
                      ____________________________________________________________
consensus CTCACTGCGAGAGAATCAGTATTTCAATGGCGAAGACCGGAGAGGGCAGCAGATCAAGAT
 
. : . : . : . : . : . :
JMSF002E18- GGTCTCTTACAGGGATGACCGCTCTGGTCACCGGAGGAACTCGTGGAATCGGGCGTGCGA
                      ____________________________________________________________
consensus GGTCTCTTACAGGGATGACCGCTCTGGTCACCGGAGGAACTCGTGGAATCGGGCGTGCGA
 
. : . : . : . : . : . :
JMSF002E18- TCGTGGAGGAACTAGCTGAACTGGGCGCCAGTGTGTACACATGTTCGAGAAAGGAAGAAG
                      ____________________________________________________________
consensus TCGTGGAGGAACTAGCTGAACTGGGCGCCAGTGTGTACACATGTTCGAGAAAGGAAGAAG
 
. : . : . : . : . : . :
JMSF002E18- AACTGAACCAACGCTTGCAAGAATGGGCTGCGAAAGGCCTCAAAGTCTCCGGTTCCGTCT
                      ____________________________________________________________
consensus AACTGAACCAACGCTTGCAAGAATGGGCTGCGAAAGGCCTCAAAGTCTCCGGTTCCGTCT
 
. : . : . : . : . : . :
JMSF002E18- GCGATGCTTCGTCTGCAGACCAGCGGGTGCTGCTCTCGCAGAAGGTTTCCTCCGCCTTTG
rJMFF030O19+ CCTTTG
                      ____________________________________________________________
consensus GCGATGCTTCGTCTGCAGACCAGCGGGTGCTGCTCTCGCAGAAGGTTTCCTCCGCCTTTG
 
. : . : . : . : . : . :
JMSF002E18- ATGGCAAGCTCAACATTCTTGTTAACAATGTTGGGACAAACATCAGGAAGCCTACAACTG
rJMFF030O19+ ATGGCAAGCTCAACATTCTTATCAACAATGTTGGGACAAACATCAAGAAGTCCACAGCTG
                      ____________________________________________________________
consensus ATGGCAAGCTCAACATTCTTGTTAACAATGTTGGGACAAACATCAGGAAGTCTACAGCTG
 
. : . : . : . : . : . :
JMSF002E18- AGTATACTACTGAAGAATATTCTTATCTCATGGCTACCAACTTAGAGTCCTCTTACCAT
rJMFF030O19+ AGTACACTATGGAAGAATACTCTTTAATCATGGCTACCAACTTAGAGTCTTCTTACCATT
                      ____________________________________________________________
consensus AGTATACTATTGAAGAATATTCTTTTCTCATGGCTACCAACTTAGAGTCTTCTTACCATT
 
. : . : . : . : . : . :
rJMFF030O19+ TGTCTCAGCTTGCGTACCCTCTCTTGAAAGCATCTGGAGCTGGATGCATTGTCTTTGTCT
                      ____________________________________________________________
consensus TGTCTCAGCTTGCGTACCCTCTCTTGAAAGCATCTGGAGCTGGATGCATTGTCTTTGTCT
 
. : . : . : . : . : . :
rJMFF030O19+ CCTCTGTTGCTGGCTTGGTACACATATATACGGGATCAATCTATGGAGCAACCAAAGGGG
                      ____________________________________________________________
consensus CCTCTGTTGCTGGCTTGGTACACATATATACGGGATCAATCTATGGAGCAACCAAAGGGG
 
. : . : . : . : . : . :
rJMFF030O19+ CTATGAATCAGCTTACCAAGAATTTGGCTTGCGAATGGGCAAAAGATAACATTAGGGTCA
                      ____________________________________________________________
consensus CTATGAATCAGCTTACCAAGAATTTGGCTTGCGAATGGGCAAAAGATAACATTAGGGTCA
 
. : . : . : . : . : . :
rJMFF030O19+ ATTCCGTTGCCCCTTGGTATATCAGAACCTCGCTTGTGCAACATGTTCTTGAGAAGGAGG
rJMSF002O20+ GTTCTTGAGAAGGAGG
                      ____________________________________________________________
consensus ATTCCGTTGCCCCTTGGTATATCAGAACCTCGCTTGTGCAACATGTTCTTGAGAAGGAGG
 
. : . : . : . : . : . :
rJMFF030O19+ AGTTTATGGATAGGGTGATATCCAGGACTCCTTTCAGGCGGATCGGGGAACCAGAAGAGG
rJMSF002O20+ AGTTTATGGATAGGGTGATATCCAGGACTCCTTTCAGGCGGATCGGGGAACCAGAAGAGG
                      ____________________________________________________________
consensus AGTTTATGGATAGGGTGATATCCAGGACTCCTTTCAGGCGGATCGGGGAACCAGAAGAGG
 
. : . : . : . : . : . :
rJMFF030O19+ TTTCATCAGTGGTTGCTTTCCTGTGTCTTCCTTCAGCTTCTTATGTGACTGGGCAGATTA
rJMSF002O20+ TTTCATCAGTGGTTGCTTTCCTGTGTCTTCCTTCAGCTTCTTATGTGACTGGGCAGATTA
                      ____________________________________________________________
consensus TTTCATCAGTGGTTGCTTTCCTGTGTCTTCCTTCAGCTTCTTATGTGACTGGGCAGATTA
 
. : . : . : . : . : . :
rJMFF030O19+ TAGCTGTTGATGGTGGTTTTACAGTGAATGGGTTTGAATGAGAATCAAAAACTGGTTTCA
rJMSF002O20+ TAGCTGTTGATGGTGGTTTTACAGTGAATGGGTTTGAATGAGAATCAAAAACTGGTTTCA
                      ____________________________________________________________
consensus TAGCTGTTGATGGTGGTTTTACAGTGAATGGGTTTGAATGAGAATCAAAAACTGGTTTCA
 
. : . : . : . : . : . :
rJMFF030O19+ ATTCCTTCCATGTTCATCATGTGTGTTTAGTTAGTGTCTTTGATCTGCCATTTGCAGTTC
rJMSF002O20+ ATTCCTTCCATGTTCATCATGTGTGTTTAGTTAGTGTCTTTGATCTGCCATTTGCAGTTC
                      ____________________________________________________________
consensus ATTCCTTCCATGTTCATCATGTGTGTTTAGTTAGTGTCTTTGATCTGCCATTTGCAGTTC
 
. : . : . : . : . : . :
rJMFF030O19+ TGTGGTTTCTTTGTGAACCAGTTCTAGCTGAATCAAGTTGACAGTAT
rJMSF002O20+ TGTGGTTTCTTTGTGAACCAGTTCTAGCTGAATCAAGTTGACAGTATTAATAATGCATAT
                      ____________________________________________________________
consensus TGTGGTTTCTTTGTGAACCAGTTCTAGCTGAATCAAGTTGACAGTATTAATAATGCATAT
 
. : . : . : . : . : . :
rJMSF002O20+ ATATGCACAATACTATCTTCTCATATATATGTTTCTCTTCATCCTTTATACTTAAACTAG
                      ____________________________________________________________
consensus ATATGCACAATACTATCTTCTCATATATATGTTTCTCTTCATCCTTTATACTTAAACTAG
 
. : . : . : . : . : . :
rJMSF002O20+ GTGGTCCAAACAAGGACCATTTTTCCCCAGCTAGATTTCATGTCAAGAGGGATTGCAACC
                      ____________________________________________________________
consensus GTGGTCCAAACAAGGACCATTTTTCCCCAGCTAGATTTCATGTCAAGAGGGATTGCAACC
 
. : . : . : . : . : . :
rJMSF002O20+ AGGTTGGGCCCTTTGGGTTTTGGTCACAATAACCCACCATCCATTGGTATGTATATTGAT
                      ____________________________________________________________
consensus AGGTTGGGCCCTTTGGGTTTTGGTCACAATAACCCACCATCCATTGGTATGTATATTGAT