Previous Contig 011234:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002O19Sequence232011234 (4)gb:AP000382_18198763e-35Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K7M2.714011234 (4)sp|P58905|AT11_LYCES1e-68Ammonium transporter 1, member 1 (LeAMT1;1).
JMSF039P10Sequence647011234 (4)sp|P58905|AT11_LYCES1e-68Ammonium transporter 1, member 1 (LeAMT1;1).706011234 (4)sp|P58905|AT11_LYCES1e-68Ammonium transporter 1, member 1 (LeAMT1;1).

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF002O19- GGGCGGGTTCGCCGCCATCACGTCCGGATGCTCCGTCGTAGAACCGTGGGCTGC
JMSF039P10- GGGCGGGTTCGCCGCCATCACGTCCGGATGCTCCGTCGTAGAACCGTGGGCTGC
rJMSF039P10+ GGGCGGGTTCGCCGCCATCACGTCCGGATGCTCCGTCGTAGAACCGTGGGCTGC
rJMSF002O19+ GGGCGGGTTCGCCGCCATCACGTCCGGATGCTCCGTCGTAGAACCGTGGGCTGC
                      ____________________________________________________________
consensus GGGCGGGTTCGCCGCCATCACGTCCGGATGCTCCGTCGTAGAACCGTGGGCTGC
 
. : . : . : . : . : . :
JMSF002O19- GATCGTTTGCGGGTTTGTGGCGGCTCTGGTCTTAATCGGATGCAACAAACTGGCGGAAAT
JMSF039P10- GATCGTTTGCGGGTTTGTGGCGGCTCTGGTCTTAATCGGATGCAACAAACTGGCGGAAAT
rJMSF039P10+ GATCGTTTGCGGGTTTGTGGCGGCTCTGGTCTTAATCGGATGCAACAAACTGGCGGAAAT
rJMSF002O19+ GATCGTTTGCGGGTTTGTGGCGGCTCTGGTCTTAATCGGATGCAACAAACTGGCGGAAAT
                      ____________________________________________________________
consensus GATCGTTTGCGGGTTTGTGGCGGCTCTGGTCTTAATCGGATGCAACAAACTGGCGGAAAT
 
. : . : . : . : . : . :
JMSF002O19- CTTCAAATACGACGATCCATTGGAGGCGGCGCAACTGCATGGCGGTTGTGGAGCATGGGG
JMSF039P10- CTTCAAATACGACGATCCATTGGAGGCGGCGCAACTGCATGGCGGTTGTGGAGCATGGGG
rJMSF039P10+ CTTCAAATACGACGATCCATTGGAGGCGGCGCAACTGCATGGCGGTTGTGGAGCATGGGG
rJMSF002O19+ CTTCAAATACGACGATCCATTGGAGGCGGCGCAACTGCATGGCGGTTGTGGAGCATGGGG
                      ____________________________________________________________
consensus CTTCAAATACGACGATCCATTGGAGGCGGCGCAACTGCATGGCGGTTGTGGAGCATGGGG
 
. : . : . : . : . : . :
JMSF002O19- AATCATTTTCACGGGCTTATTTGCCAAGAAGAAGTACGTGAACGAGGTTTACCCTGGT
JMSF039P10- AATCATTTTCACGGGCTTATTTGCCAAGAAGAAGTACGTGAACGAGGTTTACCCTGGTGT
rJMSF039P10+ AATCATTTTCACGGGCTTATTTGCCAAGAAGAAGTACGTGAACGAGGTTTACCCTGGTGT
rJMSF002O19+ AATCATTTTCACGGGCTTATTTGCCAAGAAGAAGTACGTGAACGAGGTTTACCCTGGTGT
                      ____________________________________________________________
consensus AATCATTTTCACGGGCTTATTTGCCAAGAAGAAGTACGTGAACGAGGTTTACCCTGGTGT
 
. : . : . : . : . : . :
JMSF039P10- GCCGGGTCGACCATACGGGTTGTTAATGGGTGGCGGTGGGAAGTTACTGGGAGCCCACAT
rJMSF039P10+ GCCGGGTCGACCATACGGGTTGTTAATGGGTGGCGGTGGGAAGTTACTGGGAGCCCACAT
rJMSF002O19+ GCCGGGTCGACCATACGGGTTGTTAATGGGTGGCGGTGGGAAGTTACTGGGAGCCCACAT
                      ____________________________________________________________
consensus GCCGGGTCGACCATACGGGTTGTTAATGGGTGGCGGTGGGAAGTTACTGGGAGCCCACAT
 
. : . : . : . : . : . :
JMSF039P10- AATCCAGATACTCGTAATATCGGGATGGGTAAGCATTACAATGGGTCCCCTTTTCTACAT
rJMSF039P10+ AATCCAGATACTCGTAATATCGGGATGGGTAAGCATTACAATGGGTCCCCTTTTCTACAT
rJMSF002O19+ AATCCAGATACTCGTAATATCGGGATGGGTAAGCATTACAATGGGTCCCCTTTTCTACAT
                      ____________________________________________________________
consensus AATCCAGATACTCGTAATATCGGGATGGGTAAGCATTACAATGGGTCCCCTTTTCTACAT
 
. : . : . : . : . : . :
JMSF039P10- TCTTCATAAGCTAAAACTTTTACGAATCTCCCCCGATGACGAAATGGCGGGTATGGATTT
rJMSF039P10+ TCTTCATAAGCTAAAACTTTTACGAATCTCCCCCGATGACGAAATGGCGGGTATGGATTT
rJMSF002O19+ TCTTCATAAGCTAAAACTTTTACGAATCTCCCCCGATGACGAAATGGCGGGTATGGATTT
                      ____________________________________________________________
consensus TCTTCATAAGCTAAAACTTTTACGAATCTCCCCCGATGACGAAATGGCGGGTATGGATTT
 
. : . : . : . : . : . :
JMSF039P10- GACCCGCCATGGAGGGTTTGCATATTACCATGAAGAAGATTATCTCAAGCCTGGGATTCA
rJMSF039P10+ GACCCGCCATGGAGGGTTTGCATATTACCATGAAGAAGATTATCTCAAGCCTGGGATTCA
rJMSF002O19+ GACCCGCCATGGAGGGTTTGCATATTACCATGAAGAAGATTATCTCAAGCCTGGGATTCA
                      ____________________________________________________________
consensus GACCCGCCATGGAGGGTTTGCATATTACCATGAAGAAGATTATCTCAAGCCTGGGATTCA
 
. : . : . : . : . : . :
JMSF039P10- AATGGGGAAAATTGAATCCGCTGCTTCAAGTTAAATAATTTATTTGGATTATTATTGTTT
rJMSF039P10+ AATGGGGAAAATTGAATCCGCTGCTTCAAGTTAAATAATTTATTTGGATTATTATTGTTT
rJMSF002O19+ AATGGGGAAAATTGAATCCGCTGCTTCAAGTTAAATAATTTATTTGGATTATTATTGTTT
                      ____________________________________________________________
consensus AATGGGGAAAATTGAATCCGCTGCTTCAAGTTAAATAATTTATTTGGATTATTATTGTTT
 
. : . : . : . : . : . :
JMSF039P10- ACAAATACTATACTATATAGTAACAATTAGTAGTGTACGTAAATTCAGAGAAAATGATAT
rJMSF039P10+ ACAAATACTATACTATATAGTAACAATTAGTAGTGTACGTAAATTCAGAGAAAATGATAT
rJMSF002O19+ ACAAATACTATACTATATAGTAACAATTAGTAGTGTACGTAAATTCAGAGAAAATGATAT
                      ____________________________________________________________
consensus ACAAATACTATACTATATAGTAACAATTAGTAGTGTACGTAAATTCAGAGAAAATGATAT
 
. : . : . : . : . : . :
JMSF039P10- TGAAGCTCTTCCATATATATGAAAAGTTTTAGATTAATAATGGTTGGTTGATT
rJMSF039P10+ TGAAGCTCTTCCATATATATGAAAAGTTTTAGATTAATAATGGTTGGTTGATTGAAAGAA
rJMSF002O19+ TGAAGCTCTTCCATATATATGAAAAGTTTTAGATTAATAATGGTTGGTTGATTGAAAGAA
                      ____________________________________________________________
consensus TGAAGCTCTTCCATATATATGAAAAGTTTTAGATTAATAATGGTTGGTTGATTGAAAGAA
 
. : . : . : . : . : . :
rJMSF039P10+ GATATTGTAAA-CATGAGGA-CAAGGTTTTCTGATATAATTTGTCATTTCCCTT
rJMSF002O19+ GATATTGTAAACCATGAGGACCAAGGTTTTCTGATATAATTTGTCATTTCCCTTATCTAC
                      ____________________________________________________________
consensus GATATTGTAAACCATGAGGACCAAGGTTTTCTGATATAATTTGTCATTTCCCTTATCTAC