Previous Contig 011230:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF040N20Sequence288007217 (6)gb:AY099822_15768470.002Arabidopsis thaliana putative SF16 protein (At2g43680) mRNA, complete cds.>gb:BT489011230 (6)pir|T49310|T493102e-26hypothetical protein T16L24.240 - Arabidopsis thaliana>gb:ATT16L24_1554659 Arabi
JMSF002M08Sequence227007217 (6)707011230 (6)pir|T49310|T493103e-28hypothetical protein T16L24.240 - Arabidopsis thaliana>gb:ATT16L24_1554659 Arabi
JMSF013J03Sequence248007217 (6)745011230 (6)pir|T49310|T493101e-28hypothetical protein T16L24.240 - Arabidopsis thaliana>gb:ATT16L24_1554659 Arabi
JMSF017P04Sequence489007217 (6)gb:AY099822_15768474e-20Arabidopsis thaliana putative SF16 protein (At2g43680) mRNA, complete cds.>gb:BT745011230 (6)pir|T49310|T493101e-28hypothetical protein T16L24.240 - Arabidopsis thaliana>gb:ATT16L24_1554659 Arabi
JMSF038H06Sequence683007217 (6)gb:AY099822_15768472e-23Arabidopsis thaliana putative SF16 protein (At2g43680) mRNA, complete cds.>gb:BT886011230 (6)pir|T49310|T493101e-31hypothetical protein T16L24.240 - Arabidopsis thaliana>gb:ATT16L24_1554659 Arabi
JMSF050D11Sequence701007217 (6)gb:AY099822_15768473e-14Arabidopsis thaliana putative SF16 protein (At2g43680) mRNA, complete cds.>gb:BT727011230 (6)pir|T49310|T493109e-29hypothetical protein T16L24.240 - Arabidopsis thaliana>gb:ATT16L24_1554659 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF038H06+ CCGATCCAGTGGGATACCCGTGGTGGTGGAACTGGTTAGAACGCCAG
                      ____________________________________________________________
consensus CCGATCCAGTGGGATACCCGTGGTGGTGGAACTGGTTAGAACGCCAG
 
. : . : . : . : . : . :
rJMSF017P04+ TGCTGTG
rJMSF013J03+ TGCTGTG
rJMSF038H06+ CTGCCTCCTCCTGCAGCAGCAGCAGCAGCCGCCAATCCTTCAGAAAACCAGTCTGCTGTG
rJMSF050D11+ TGCTGTG
                      ____________________________________________________________
consensus CTGCCTCCTCCTGCAGCAGCAGCAGCAGCCGCCAATCCTTCAGAAAACCAGTCTGCTGTG
 
. : . : . : . : . : . :
rJMSF017P04+ AAAAATGTCCACCTAACACCACCTAGGCCGGTATCAGACCGCAAACCACCTAGTCCTCGA
rJMSF013J03+ AAAAATGTCCACCTAACACCACCTAGGCCGGTATCAGACCGCAAACCACCTAGTCCTCGA
rJMSF038H06+ AAAAATGTCCACCTAACACCACCTAGGCCGGTATCAGACCGCAAACCACCTAGTCCTCGA
rJMSF050D11+ AAAAATGTCCACCTAACACCACCTAGGCCGGTATCAGACCGCAAACCACCTAGTCCTCGA
rJMSF002M08+ TAACACCACCTAGGCCGGTATCAGACCGCAAACCACCTAGTCCTCGA
                      ____________________________________________________________
consensus AAAAATGTCCACCTAACACCACCTAGGCCGGTATCAGACCGCAAACCACCTAGTCCTCGA
 
. : . : . : . : . : . :
rJMSF017P04+ CTTCCAGCTACCAACTTCAAACCCCAAAACAGTGGATACGACAATCACGAAGCAGGCACA
rJMSF013J03+ CTTCCAGCTACCAACTTCAAACCCCAAAACAGTGGATACGACAATCACGAAGCAGGCACA
rJMSF038H06+ CTTCCAGCTACCAACTTCAAACCCCAAAACAGTGGATACGACAATCACGAAGCAGGCACA
rJMSF050D11+ CTTCCAGCTACCAACTTCAAACCCCAAAACAGTGGATACGACAATCACGAAGCAGGCACA
rJMSF002M08+ CTTCCAGCTACCAACTTCAAACCCCAAAACAGTGGATACGACAATCACGAAGCAGGCACA
                      ____________________________________________________________
consensus CTTCCAGCTACCAACTTCAAACCCCAAAACAGTGGATACGACAATCACGAAGCAGGCACA
 
. : . : . : . : . : . :
rJMSF017P04+ CCAACATCCTCAAAATCTGCAGTTCCTGTGAGAGGCAAACAGTTCAGCACTCCTGGCAGA
rJMSF013J03+ CCAACATCCTCAAAATCTGCAGTTCCTGTGAGAGGCAAACAGTTCAGCACTCCTGGCAGA
rJMSF038H06+ CCAACATCCTCAAAATCTGCAGTTCCTGTGAGAGGCAAACAGTTCAGCACTCCTGGCAGA
rJMSF050D11+ CCAACATCCTCAAAATCTGCAGTTCCTGTGAGAGGCAAACAGTTCAGCACTCCTGGCAGA
rJMSF002M08+ CCAACATCCTCAAAATCTGCAGTTCCTGTGAGAGGCAAACAGTTCAGCACTCCTGGCAGA
                      ____________________________________________________________
consensus CCAACATCCTCAAAATCTGCAGTTCCTGTGAGAGGCAAACAGTTCAGCACTCCTGGCAGA
 
. : . : . : . : . : . :
rJMSF017P04+ ACAACCCCGCCCAGCTCGAGTTTAGCCAAATTGATGCAACCTAGAGGCAGTGGCATTCGT
rJMSF013J03+ ACAACCCCGCCCAGCTCGAGTTTAGCCAAATTGATGCAACCTAGAGGCAGTGGCATTCGT
rJMSF038H06+ ACAACCCCGCCCAGCTCGAGTTTAGCCAAATTGATGCAACCTAGAGGCAGTGGCATTCGT
rJMSF050D11+ ACAACCCCGCCCAGCTCGAGTTTAGCCAAATTGATGCAACCTAGAGGCAGTGGCATTCGT
rJMFF040N20+ CCAGCTCGAGTTTAGCCAAATTGATGCAACCTAGAGGCAGTGGCATTNGT
rJMSF002M08+ ACAACCCCGCCCAGCTCGAGTTTAGCCAAATTGATGCAACCTAGAGGCAGTGGCATTCGT
                      ____________________________________________________________
consensus ACAACCCCGCCCAGCTCGAGTTTAGCCAAATTGATGCAACCTAGAGGCAGTGGCATTCGT
 
. : . : . : . : . : . :
rJMSF017P04+ TCCCCTTTCGACTTCCCCTTGAAGGACGACGATAGCCTAACAAGCTGCCCTCCATTCTCG
rJMSF013J03+ TCCCCTTTCGACTTCCCCTTGAAGGACGACGATAGCCTAACAAGCTGCCCTCCATTCTCG
rJMSF038H06+ TCCCCTTTCGACTTCCCCTTGAAGGACGACGATAGCCTAACAAGCTGCCCTCCATTCTCG
rJMSF050D11+ TCCCCTTTCGACTTCCCCTTGAAGGACGACGATAGCCTAACAAGCTGCCCTCCATTCTCG
rJMFF040N20+ TCCCCTTTCGACTTCCCCTTGAAGGACGACGATAGCCTAACAAGCTGCCCTCCATTCTCG
rJMSF002M08+ TCCCCTTTCGACTTCCCCTTGAAGGACGACGATAGCCTAACAAGCTGCCCTCCATTCTCG
                      ____________________________________________________________
consensus TCCCCTTTCGACTTCCCCTTGAAGGACGACGATAGCCTAACAAGCTGCCCTCCATTCTCG
 
. : . : . : . : . : . :
rJMSF017P04+ GTCCCAAGTTACATGGCGCCTACCGTCTCTGCCAAGGCCAAAGCAAGAGCAAGTAGCAAC
rJMSF013J03+ GTCCCAAGTTACATGGCGCCTACCGTCTCTGCCAAGGCCAAAGCAAGAGCAAGTAGCAAC
rJMSF038H06+ GTCCCAAGTTACATGGCGCCTACCGTCTCTGCCAAGGCCNAAGCAAGAGCAAGTAGCAAC
rJMSF050D11+ GTCCCAAGTTACATGGCGCCTACCGTCTCTGCCAAGGCCAAAGCAAGAGCAAGTAGCAAC
rJMFF040N20+ GTCCCAAGTTACATGGCGCCTACCGTCTCTGCCAAGGCCAAAGCAAGAGCAAGTAGCAAC
rJMSF002M08+ GTCCCAAGTTACATGGCGCCTACCGTCTCTGCCAAGGCCAAAGCAAGAGCAAGTAGCAAC
                      ____________________________________________________________
consensus GTCCCAAGTTACATGGCGCCTACCGTCTCTGCCAAGGCCAAAGCAAGAGCAAGTAGCAAC
 
. : . : . : . : . : . :
rJMSF017P04+ CCGAGGGAGAGGAGTACAAGTAGTGCTGCAGGAACACCGACAAATGACTCAAAGCGGAGG
rJMSF013J03+ CCGAGGGAGAGAAGTACAAGTAGTGCTGCAGGAACACCGACAAATGACTCAAAGCGGAGG
rJMSF038H06+ CCGAGGGAGAGAAGTACAAGTAGTGCTGCAGGAACACCGACAAATGACTCAAAGCGGAGG
rJMSF050D11+ CCGAGGGAGAGAAGTACAAGTAGTGCTGCAGGAACACCGACAAATGACTCAAAGCGGAGG
rJMFF040N20+ CCGAGGGAGAGAAGTACAAGTAGTGCTGCAGGAACACCGACAAATGACTCAAAGCGGAGG
rJMSF002M08+ CCGAGGGAGAGAAGTACAAGTAGTGCTGCAGGAACACCGACAAATGACTCAAAGCGGAGG
                      ____________________________________________________________
consensus CCGAGGGAGAGAAGTACAAGTAGTGCTGCAGGAACACCGACAAATGACTCAAAGCGGAGG
 
. : . : . : . : . : . :
rJMSF017P04+ TTTTCCTTTCCCTTGACCCCGAATATCGCATCTTTCAAGTGGAACAGAGGCTCCAGCAAA
rJMSF013J03+ TTTTCCTTTCCCTTGACCCCGAATATCGCATCTTTCAAGTGGAACAGAGGCTCCAGCAAA
rJMSF038H06+ TTTTCCTTTCCCTTGACCCCGAATATCGCATCTTTCAAGTGGAACAGAGGCTCCAGCAAA
rJMSF050D11+ TTTTCCTTTCCCTTGACCCCGAATATCGCATCTTTCAAGTGGAACAGAGGCTCCAGCAAA
rJMFF040N20+ TTTTCCTTTCCCTTGACCCCGAATATCGCATCTTTCAAGTGGAACAGAGGCTCCAGCAAA
rJMSF002M08+ TTTTCCTTTCCCTTGACCCCGAATATCGCATCTTTCAAGTGGAACAGAGGCTCCAGCAAA
                      ____________________________________________________________
consensus TTTTCCTTTCCCTTGACCCCGAATATCGCATCTTTCAAGTGGAACAGAGGCTCCAGCAAA
 
. : . : . : . : . : . :
rJMSF017P04+ GATCCTACTACTCCTCAAAGGGAAACAGAGAAGCAAGGTGGAGATGGAGTGAGTGTGGAT
rJMSF013J03+ GATCCTACTACTCCTCAAAGGGAAACAGAGAAGCAAGGTGGAGATGGAGTGAGTGTGGAT
rJMSF038H06+ GATCCTACTACTCCTCAAAGGGAAACAGAGAAGCAAGGTGGAGATGGAGTGAGTGTGGAT
rJMSF050D11+ GATCCTACTACTCCTCAAAGGGAAACAGAGAAGCAAGGTGGAGATGGAGTGAGTGTGGAT
rJMFF040N20+ GATCCTACTACTCCTCAAAGGGAAACAGAGAAGCAAGGTGGAGATGGAGTGAGTGTGGAT
rJMSF002M08+ GATCCTACTACTCCTCAAAGGGAAACAGAGAAGCAAGGTGGAGATGGAGTGAGTGTGGAT
                      ____________________________________________________________
consensus GATCCTACTACTCCTCAAAGGGAAACAGAGAAGCAAGGTGGAGATGGAGTGAGTGTGGAT
 
. : . : . : . : . : . :
rJMSF017P04+ TCAACTGTTTCTATGCCAGCTATAGTTGGGAGGAAACCATTTAACAGATTTGTGTGATTG
rJMSF013J03+ TCAACTGTTTCTATGCCAGCTATAGTTGGGAGGAAACCATTTAACAGATTTGTGTGATTG
rJMSF038H06+ TCAACTGTTTCTANGCCAGCTATAGTTGGGAGGAAACCATTTAACAGATTTGTGTGATTG
rJMSF050D11+ TCAACTGTTTCTATGCCAGCTATAGTTGGGAGGAAACCATTTAACAGATTTGTGTGATTG
rJMFF040N20+ TCAACTGTTTCTATGCCAGCTATAGTTGGGAGGAAACCATTTAACAGATTTGTGTGATTG
rJMSF002M08+ TCAACTGTTTCTATGCCAGCTATAGTTGGGAGGAAACCATTTAACAGATTTGTGTGATTG
                      ____________________________________________________________
consensus TCAACTGTTTCTATGCCAGCTATAGTTGGGAGGAAACCATTTAACAGATTTGTGTGATTG
 
. : . : . : . : . : . :
rJMSF017P04+ GATTTCTT
rJMSF013J03+ GATTTCTT
rJMSF038H06+ GATTTCTT
rJMSF050D11+ GATTTCTTTTTCTTTTTCTTTTTTTGTTAACATCTGTATTAACCATTTTGAGGTTGCTTT
rJMFF040N20+ GATTTCTTTTTCTTTTTCTTTTTTTGTTAACATCTGTATTAACCATTTTGAGGTTGCTTT
rJMSF002M08+ GATTTCTTTTTCTTTTTCTTTTTTTGTTAACATCTGTATTAACCATTTTGAGGTTGCTTT
                      ____________________________________________________________
consensus GATTTCTTTTTCTTTTTCTTTTTTTGTTAACATCTGTATTAACCATTTTGAGGTTGCTTT
 
. : . : . : . : . : . :
rJMSF050D11+ GTGTCTTTTCATGTATACCTACCTACCTACCTGAGTGTGTATTTATTTGGTGATATATGT
rJMFF040N20+ GTGTCTTTTCATGTATACC
rJMSF002M08+ GTGTCTTTTCATGTATACCTACCTACCTACCTGAGTGTGTATTTATTTGGTGATATATGT
                      ____________________________________________________________
consensus GTGTCTTTTCATGTATACCTACCTACCTACCTGAGTGTGTATTTATTTGGTGATATATGT