Previous Contig 011227:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002L09Sequence441004438 (2)gb:BT004983_16379291e-10Arabidopsis thaliana clone U50567 unknown protein (At1g79020) mRNA, complete cds737011227 (2)gb:BT004983_16379297e-21Arabidopsis thaliana clone U50567 unknown protein (At1g79020) mRNA, complete cds
JMSF044E06Sequence809004438 (2)gb:BT004983_16379293e-71Arabidopsis thaliana clone U50567 unknown protein (At1g79020) mRNA, complete cds770011227 (2)gb:BT004983_16379298e-23Arabidopsis thaliana clone U50567 unknown protein (At1g79020) mRNA, complete cds

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF044E06+ TTTCCAAGCAAGGTTGGTTCAAGTGAGGATGAGTTTGTTGACTCGGATGATGTTGGTGT
                      ____________________________________________________________
consensus TTTCCAAGCAAGGTTGGTTCAAGTGAGGATGAGTTTGTTGACTCGGATGATGTTGGTGT
 
. : . : . : . : . : . :
rJMSF044E06+ TGGCCGTCCATATGCTCGGCCTTCTATGGTACACTCTATGCCTTTTACAGACTCAAAGAT
                      ____________________________________________________________
consensus TGGCCGTCCATATGCTCGGCCTTCTATGGTACACTCTATGCCTTTTACAGACTCAAAGAT
 
. : . : . : . : . : . :
rJMSF044E06+ GGTGGCAGTTTCCACTGGAAGCATAAGACGGGACTTCAAACGACGTCAGACCCCATATGG
                      ____________________________________________________________
consensus GGTGGCAGTTTCCACTGGAAGCATAAGACGGGACTTCAAACGACGTCAGACCCCATATGG
 
. : . : . : . : . : . :
rJMSF044E06+ ATGGCTCCAAAAATTGGATCCTAATGAGCCAGTTCTGCTGTTCACGAAACCTCTGGATCC
rJMSF002L09+ GGATCCTAATGAGCCAGTTCTGCTGTTCACGAAACCTCTGGATCC
                      ____________________________________________________________
consensus ATGGCTCCAAAAATTGGATCCTAATGAGCCAGTTCTGCTGTTCACGAAACCTCTGGATCC
 
. : . : . : . : . : . :
rJMSF044E06+ CGAGAAACTGGCAGCTGCAGGCATTAAGCCACCAACAGATTCATCAATGGCCGATGGCAT
rJMSF002L09+ CGAGAAACTGGCAGCTGCAGGCATTAAGCCACCAACAGATTCATCAATGGCCGATGGCAT
                      ____________________________________________________________
consensus CGAGAAACTGGCAGCTGCAGGCATTAAGCCACCAACAGATTCATCAATGGCCGATGGCAT
 
. : . : . : . : . : . :
rJMSF044E06+ ACTAGGACGCTCATTGAATTTGCGTGGACGAATTGGCAGGGGTGGCCGACTGGTGTTTGA
rJMSF002L09+ ACTAGGACGCTCATTGAATTTGCGTGGACGAATTGGCAGGGGTGGCCGACTGGTGTTTGA
                      ____________________________________________________________
consensus ACTAGGACGCTCATTGAATTTGCGTGGACGAATTGGCAGGGGTGGCCGACTGGTGTTTGA
 
. : . : . : . : . : . :
rJMSF044E06+ CAGATGGAATCCACTTATGCATACTCCAATCGAGTGTGGCGATACTTTCTACCTACCACC
rJMSF002L09+ CAGATGGAATCCACTTATGCATACTCCAATCGAGTGTGGCGATACTTTCTACCTACCACC
                      ____________________________________________________________
consensus CAGATGGAATCCACTTATGCATACTCCAATCGAGTGTGGCGATACTTTCTACCTACCACC
 
. : . : . : . : . : . :
rJMSF044E06+ AAAGCCCCGACCAGCCACTCATCGCTGATAGATATTAAATGTTATTTCCAGTTCTTGAAC
rJMSF002L09+ AAAGCCCCGACCAGCCACTCATCGCTGATAGATATTAAATGTTATTTCCAGTTCTTGAAC
                      ____________________________________________________________
consensus AAAGCCCCGACCAGCCACTCATCGCTGATAGATATTAAATGTTATTTCCAGTTCTTGAAC
 
. : . : . : . : . : . :
rJMSF044E06+ TTGGAAGAGTATGCTCTCTGCTCTGGGTTTACCACAGCCCATTGTGCAATTAACATTGTA
rJMSF002L09+ TTGGAAGAGTATGCTCTCTGCTCTGGGTTTACCACAGCCCATTGTGCAATTAACATTGTA
                      ____________________________________________________________
consensus TTGGAAGAGTATGCTCTCTGCTCTGGGTTTACCACAGCCCATTGTGCAATTAACATTGTA
 
. : . : . : . : . : . :
rJMSF044E06+ TTCTTCAAGGTTAGGAAAAGGGGCACCCTTTGTACAATTAGTGGTATTCTCTTGTTTTTT
rJMSF002L09+ TTCTTCAAGGTTAGGAAAAGGGGCACCCTTTGTACAATTAGTGGTATTCTCTTGTTTTTT
                      ____________________________________________________________
consensus TTCTTCAAGGTTAGGAAAAGGGGCACCCTTTGTACAATTAGTGGTATTCTCTTGTTTTTT
 
. : . : . : . : . : . :
rJMSF044E06+ CGAGGCTAGTGGGTAGAAAGGAAGAGCACAACAGAGCGTCTTTGTTGCGGATGTAGCAAC
rJMSF002L09+ CGAGGCTAGTGGGTAGAAAGGAAGAGCACAACAGAGCGTCTTTGTTGCGGATGTAGCAAC
                      ____________________________________________________________
consensus CGAGGCTAGTGGGTAGAAAGGAAGAGCACAACAGAGCGTCTTTGTTGCGGATGTAGCAAC
 
. : . : . : . : . : . :
rJMSF044E06+ ATGATGGGCTAACCGTTGATTGCTAAACAAGCCCGATGTTTGAAGCAAATGCTTAGATAG
rJMSF002L09+ ATGATGGGCTAACCGTTGATTGCTAAACAAGCCCGATGTTTGAAGCAAATGCTTAGATAG
                      ____________________________________________________________
consensus ATGATGGGCTAACCGTTGATTGCTAAACAAGCCCGATGTTTGAAGCAAATGCTTAGATAG
 
. : . : . : . : . : . :
rJMSF044E06+ TGTATGCTTTGTTGTAAATGATTGGATTTGCATCAAGGGAGGGAGGTAGCA
rJMSF002L09+ TGTATGCTTTGTTGTAAATGATTGGATTTGCATCAAGGGAGGGAGGTAGCATAATTTCTC
                      ____________________________________________________________
consensus TGTATGCTTTGTTGTAAATGATTGGATTTGCATCAAGGGAGGGAGGTAGCATAATTTCTC
 
. : . : . : . : . : . :
rJMSF002L09+ TATTGCTGTAAATTCTGACATTTTATTTTTCTTTCTGATCAGTTTCTCTGGACCTGAAAT
                      ____________________________________________________________
consensus TATTGCTGTAAATTCTGACATTTTATTTTTCTTTCTGATCAGTTTCTCTGGACCTGAAAT