Previous Contig 011219:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002J12Sequence358018276715011219 (2)gb:BT008347_16395641e-59Arabidopsis thaliana At4g31530 mRNA, complete cds.>gb:AK117306_1815346 Arabidops
JMSF024J23Sequence132011219 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF002J12+ ATAGGTGTTACAAAATTCAACGAATTACCTTGGAGCATCATGAACCTTTTTGGTGT
                      ____________________________________________________________
consensus ATAGGTGTTACAAAATTCAACGAATTACCTTGGAGCATCATGAACCTTTTTGGTGT
 
. : . : . : . : . : . :
rJMSF002J12+ ACTCAAGTATAAGAAGATGGGGGAAGATTTTGTTCGCAATTCTGGTCTCCCATTCACTAT
                      ____________________________________________________________
consensus ACTCAAGTATAAGAAGATGGGGGAAGATTTTGTTCGCAATTCTGGTCTCCCATTCACTAT
 
. : . : . : . : . : . :
rJMSF002J12+ AATCAGAGCTGGTAGATTGACAGATGGACCATACACATCATACGATCTGAACACTCTGCT
                      ____________________________________________________________
consensus AATCAGAGCTGGTAGATTGACAGATGGACCATACACATCATACGATCTGAACACTCTGCT
 
. : . : . : . : . : . :
rJMSF002J12+ ACAGGCTACGGCTGGGGAACGGCGTGCAGTCCTTATAGGTCAAGGGGATAAACTTGTTGG
                      ____________________________________________________________
consensus ACAGGCTACGGCTGGGGAACGGCGTGCAGTCCTTATAGGTCAAGGGGATAAACTTGTTGG
 
. : . : . : . : . : . :
rJMSF002J12+ AGAAGTTAGTAGGCTTGTGGTTGCAGAAGCTTGCATACAGGCCCTGGACATAGACTTTAC
                      ____________________________________________________________
consensus AGAAGTTAGTAGGCTTGTGGTTGCAGAAGCTTGCATACAGGCCCTGGACATAGACTTTAC
 
. : . : . : . : . : . :
rJMSF002J12+ AGAGGGTCAAATATATGAAATAAACTCTATCCAGGGTGAGGGACCAGGAAGTGATCTGGA
                      ____________________________________________________________
consensus AGAGGGTCAAATATATGAAATAAACTCTATCCAGGGTGAGGGACCAGGAAGTGATCTGGA
 
. : . : . : . : . : . :
rJMSF024J23+ TACAT
rJMSF002J12+ AAAGTGGAAGGAGTTATTTAAAGCTGCCAATAACAAATAAATAACCAGTCTCTTCTACAT
                      ____________________________________________________________
consensus AAAGTGGAAGGAGTTATTTAAAGCTGCCAATAACAAATAAATAACCAGTCTCTTCTACAT
 
. : . : . : . : . : . :
rJMSF024J23+ ATGGNTCCGTGCAGCTATGAGTTTTGACTAGAGAAANGGTCAAATGAAATATACATATAT
rJMSF002J12+ ATGGCTCCGTGCAGCTATGAGTTTTGACTAGAGAAA-GGTCAAATGAAATATACATATAT
                      ____________________________________________________________
consensus ATGGCTCCGTGCAGCTATGAGTTTTGACTAGAGAAANGGTCAAATGAAATATACATATAT
 
. : . : . : . : . : . :
rJMSF024J23+ CAAACT
rJMSF002J12+ CAAACTTAACAGAAGATCTCCTGAGCTGGGCTTGTTCAAGAATTGGCAGATATGGAAATT
                      ____________________________________________________________
consensus CAAACTTAACAGAAGATCTCCTGAGCTGGGCTTGTTCAAGAATTGGCAGATATGGAAATT
 
. : . : . : . : . : . :
rJMSF002J12+ GAAGCTTGTTATTTCCATGCAATCATCAATGGAGCCTGCCAAACTCAAGAATGCTCACTC
                      ____________________________________________________________
consensus GAAGCTTGTTATTTCCATGCAATCATCAATGGAGCCTGCCAAACTCAAGAATGCTCACTC
 
. : . : . : . : . : . :
rJMSF002J12+ TCTCTACCTTTACTGTGATTATACTAATCCTTCTCAAACTATAGATGGACAGTGTTAATT
                      ____________________________________________________________
consensus TCTCTACCTTTACTGTGATTATACTAATCCTTCTCAAACTATAGATGGACAGTGTTAATT
 
. : . : . : . : . : . :
rJMSF002J12+ AAGGATGTATAGTATGAATGAACAGAACTTCCAAAGGTTGCCTTTCTTGAGTGTGTATTT
                      ____________________________________________________________
consensus AAGGATGTATAGTATGAATGAACAGAACTTCCAAAGGTTGCCTTTCTTGAGTGTGTATTT