Previous Contig 011208:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN016K17Sequence506011208 (3)pir|S00443|S004436e-42chlorophyll a/b-binding protein type I precursor (cab-6A) - tomato>gb:TOMCAB_172
JMSF002H06Sequence376010356 (27)pir|S28827|S288271e-07chlorophyll a/b-binding protein type I - common tobacco>gb:NTLHC1R_1691596 N.tab754011208 (3)pir|S00443|S004431e-65chlorophyll a/b-binding protein type I precursor (cab-6A) - tomato>gb:TOMCAB_172
JMSF025L22Sequence690006320 (2)gb:AF241524_17800945e-13Asarina barclaiana chlorophyll a/b-binding protein type I mRNA, partial cds.757011208 (3)pir|S00443|S004437e-69chlorophyll a/b-binding protein type I precursor (cab-6A) - tomato>gb:TOMCAB_172

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF025L22+ ACTGCAGATGGGCTATGCNT
                      ____________________________________________________________
consensus ACTGCAGATGGGCTATGCNT
 
. : . : . : . : . : . :
rJMSF025L22+ GCTGTGGTAATATTCTTTATTTCAATATTTCTATACTTATTGGATCTGTATCTCGTGAAA
                      ____________________________________________________________
consensus GCTGTGGTAATATTCTTTATTTCAATATTTCTATACTTATTGGATCTGTATCTCGTGAAA
 
. : . : . : . : . : . :
rJMSF025L22+ TGAGACTAATTTAGTGTGTGTACGTTGCAGCCTGGGATCATAATACCAGAGGCATTGGGT
rJMSF002H06+ GCCTGGGATCATAATACCAGAGGCATTGGG-
                      ____________________________________________________________
consensus TGAGACTAATTTAGTGTGTGTACGTTGCAGCCTGGGATCATAATACCAGAGGCATTGGGT
 
. : . : . : . : . : . :
rJMSF025L22+ TTGGGGAACTGGGTAAAGGCACAAGAATGGGCAGCGATTCCAGGAGGACAGGCGACGTAC
rJMSF002H06+ TTGGGGAACTGGGTAAAGGCACAAGAATGGGCAGCGATTCCAGGAGGACAGGCGACGTAC
                      ____________________________________________________________
consensus TTGGGGAACTGGGTAAAGGCACAAGAATGGGCAGCGATTCCAGGAGGACAGGCGACGTAC
 
. : . : . : . : . : . :
rJMSF025L22+ CTGGGACAGCCGGTGCCATGGGGCACACTTCCTACCATTTTGGCCATCGAATTCCTGGCC
JMFN016K17+ TTTTGGCCATCGAATTCCTGGCC
rJMSF002H06+ CTGGGACAGCCGGTGCCATGGGGCACACTTCCTACCATTTTGGCCATCGAATTCCTGGCC
                      ____________________________________________________________
consensus CTGGGACAGCCGGTGCCATGGGGCACACTTCCTACCATTTTGGCCATCGAATTCCTGGCC
 
. : . : . : . : . : . :
rJMSF025L22+ ATTGCATTCGTGGAGCACCAAAGAAGTATGGAGAAAGACACTGAGAAAAAGAAGTACCCC
JMFN016K17+ ATTGCATTCGTGGAGCACCAAAGAAGTATGGAGAAAGACACTGAGAAAAAGAAGTACCCC
rJMSF002H06+ ATTGCATTCGTGGAGCACCAAAGAAGTATGGAGAAAGACACTGAGAAAAAGAAGTACCCC
                      ____________________________________________________________
consensus ATTGCATTCGTGGAGCACCAAAGAAGTATGGAGAAAGACACTGAGAAAAAGAAGTACCCC
 
. : . : . : . : . : . :
rJMSF025L22+ GGTGGCGCCTTCGACCCCTTGGGCTACTCCAAGCAGGACCCTGCTAAACTCCACGAGCTC
JMFN016K17+ GGTGGCGCCTTCGACCCCTTGGGCTACTCCAAGCAGGACCCTGCTAAACTCCACGAGCTC
rJMSF002H06+ GGTGGCGCCTTCGACCCCTTGGGCTACTCCAAGCAGGACCCTGCTAAACTCCACGAGCTC
                      ____________________________________________________________
consensus GGTGGCGCCTTCGACCCCTTGGGCTACTCCAAGCAGGACCCTGCTAAACTCCACGAGCTC
 
. : . : . : . : . : . :
rJMSF025L22+ AAAGTCAAGGAGATCAAGAACGGTGAGAACATATCCTTCAATTTAGTATCAGAGTACATA
JMFN016K17+ AAAGTCAAGGAGATCAAGAACGGTGAGAACATATCCTTCAATTTAGTATCAGAGTACATA
rJMSF002H06+ AAAGTCAAGGAGATCAAGAACGGTGAGAACATATCCTTCAATTTAGTATCAGAGTACATA
                      ____________________________________________________________
consensus AAAGTCAAGGAGATCAAGAACGGTGAGAACATATCCTTCAATTTAGTATCAGAGTACATA
 
. : . : . : . : . : . :
rJMSF025L22+ TATTCTTCAATTTAGTATCAGAGTGACGTAATATTCCTGGTGGAATATTCTGATGTTATG
JMFN016K17+ TATTCTTCAATTTAGTATCAGAGTGACGTAATATTCCTGGTGGAATATTCTGATGTTATG
rJMSF002H06+ TATTCTTCAATTTAGTATCAGAGTGACGTAATATTCCTGGTGGAATATTCTGATGTTATG
                      ____________________________________________________________
consensus TATTCTTCAATTTAGTATCAGAGTGACGTAATATTCCTGGTGGAATATTCTGATGTTATG
 
. : . : . : . : . : . :
rJMSF025L22+ TTTTGTTGGTGTAATGAACGTACAGGTCGCCTTGCGTTGTTGGCATTCGTGGGAATCTGC
JMFN016K17+ TTTTGTTGGTGTAATGAACGTACAGGTCGCCTTGCGTTGTTGGCATTCGTGGGAATCTGC
rJMSF002H06+ TTTTGTTGGTGTAATGAACGTACAGGTCGCCTTGCGTTGTTGGCATTCGTGGGAATCTGC
                      ____________________________________________________________
consensus TTTTGTTGGTGTAATGAACGTACAGGTCGCCTTGCGTTGTTGGCATTCGTGGGAATCTGC
 
. : . : . : . : . : . :
rJMSF025L22+ GTTCAGCAGTCGGCGTACCCAGGAACAGGACCGCTGGAGAACTTGGCGAGCCACTTGGCG
JMFN016K17+ GTTCAGCAGTCGGCGTACCCAGGAACAGGACCGCTGGAGAACTTGGCGAGCCACTTGGCG
rJMSF002H06+ GTTCAGCAGTCGGCGTACCCAGGAACAGGACCGCTGGAGAACTTGGCGAGCCACTTGGCG
                      ____________________________________________________________
consensus GTTCAGCAGTCGGCGTACCCAGGAACAGGACCGCTGGAGAACTTGGCGAGCCACTTGGCG
 
. : . : . : . : . : . :
rJMSF025L22+ GATCCATGGCACAACAACATCGGAGACATTCTTACCCCTAGAACTATTTCGCCCTGAAAA
JMFN016K17+ GATCCATGGCACAACAACATCGGAGACATTTTTATCCCTAGAACTATTTCGCCCTGAAAA
rJMSF002H06+ GATCCATGGCACAACAACATCGGAGACATTCTTATCCCTAGAACTATTTCGCCCTGAAAA
                      ____________________________________________________________
consensus GATCCATGGCACAACAACATCGGAGACATTCTTATCCCTAGAACTATTTCGCCCTGAAAA
 
. : . : . : . : . : . :
rJMSF025L22+ TTATATTAATGTAAAACTCCGATCCGATGAACACAAATTTGTAATCCACTGAACTTCATT
JMFN016K17+ TTATATTAATGTAAAACTCCGATCCGATGAACACAAATTTGTAATCCACTGAACTTCATT
rJMSF002H06+ TTATATTAATGTAAAACTCCGATCCGATGAACACAAATTTGTAATCCACTGAACTTCATT
                      ____________________________________________________________
consensus TTATATTAATGTAAAACTCCGATCCGATGAACACAAATTTGTAATCCACTGAACTTCATT
 
. : . : . : . : . : . :
rJMSF025L22+ GTGAATCTTTGGGTCTG
JMFN016K17+ GTG
rJMSF002H06+ GTGAATCTTTGGGTCTGTATAAGTACATACCAATTTTATATGTGAGCTCCATGTTACTAC
                      ____________________________________________________________
consensus GTGAATCTTTGGGTCTGTATAAGTACATACCAATTTTATATGTGAGCTCCATGTTACTAC
 
. : . : . : . : . : . :
rJMSF002H06+ TAGAGAAAAAGGTAACTTGCTAGGTACCCGTGTTTTGTGTTTGATAAAGTTTTACTCTTT
                      ____________________________________________________________
consensus TAGAGAAAAAGGTAACTTGCTAGGTACCCGTGTTTTGTGTTTGATAAAGTTTTACTCTTT