Previous Contig 011204:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012A17Sequence589004045 (12)gb:AB073552_15231892e-80Bruguiera sexangula bstcp-1 mRNA for t-complex polypeptide 1, complete cds.805011204 (10)gb:AB073552_15231893e-92Bruguiera sexangula bstcp-1 mRNA for t-complex polypeptide 1, complete cds.
JMFF028J13Sequence560004045 (12)gb:AB073552_15231898e-75Bruguiera sexangula bstcp-1 mRNA for t-complex polypeptide 1, complete cds.628011204 (10)gb:BT002052_16356556e-60Arabidopsis thaliana t-complex polypeptide 1 homologue (At3g20050) mRNA, complet
JMFF029K01Sequence437004045 (12)gb:AB073552_15231896e-52Bruguiera sexangula bstcp-1 mRNA for t-complex polypeptide 1, complete cds.747011204 (10)gb:BT002052_16356551e-77Arabidopsis thaliana t-complex polypeptide 1 homologue (At3g20050) mRNA, complet
JMFF037N03Sequence597004045 (12)gb:AB073552_15231891e-81Bruguiera sexangula bstcp-1 mRNA for t-complex polypeptide 1, complete cds.762011204 (10)gb:AB073552_15231895e-87Bruguiera sexangula bstcp-1 mRNA for t-complex polypeptide 1, complete cds.
JMFF044A21Sequence628004045 (12)gb:AB073552_15231894e-86Bruguiera sexangula bstcp-1 mRNA for t-complex polypeptide 1, complete cds.582011204 (10)gb:AB073552_15231893e-50Bruguiera sexangula bstcp-1 mRNA for t-complex polypeptide 1, complete cds.
JMFS145C07Sequence625011204 (10)gb:AB073552_15231892e-99Bruguiera sexangula bstcp-1 mRNA for t-complex polypeptide 1, complete cds.
JMSF002F16Sequence264004045 (12)gb:AB073552_15231896e-20Bruguiera sexangula bstcp-1 mRNA for t-complex polypeptide 1, complete cds.769011204 (10)gb:BT002052_16356557e-80Arabidopsis thaliana t-complex polypeptide 1 homologue (At3g20050) mRNA, complet
JMSF019H12Sequence541004045 (12)gb:AB073552_15231891e-71Bruguiera sexangula bstcp-1 mRNA for t-complex polypeptide 1, complete cds.774011204 (10)gb:AB073552_15231893e-92Bruguiera sexangula bstcp-1 mRNA for t-complex polypeptide 1, complete cds.
JMSF029G02Sequence661004045 (12)gb:AB073552_15231891e-90Bruguiera sexangula bstcp-1 mRNA for t-complex polypeptide 1, complete cds.755011204 (10)gb:AB073552_15231896e-89Bruguiera sexangula bstcp-1 mRNA for t-complex polypeptide 1, complete cds.
JMSF052C06Sequence664004045 (12)gb:AB073552_15231892e-93Bruguiera sexangula bstcp-1 mRNA for t-complex polypeptide 1, complete cds.896011204 (10)gb:AB073552_1523189e-103Bruguiera sexangula bstcp-1 mRNA for t-complex polypeptide 1, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS145C07- GAGAACTGATATGACAAAAGAACGCATTGAGAAGCTTCTAAAAGCTGGA
                      ____________________________________________________________
consensus GAGAACTGATATGACAAAAGAACGCATTGAGAAGCTTCTAAAAGCTGGA
 
. : . : . : . : . : . :
JMFS145C07- GCCAATGTTATATTGACTTCCAAAGGAATTGATGACATGGCACTCAAGTACTTTGTGGAA
                      ____________________________________________________________
consensus GCCAATGTTATATTGACTTCCAAAGGAATTGATGACATGGCACTCAAGTACTTTGTGGAA
 
. : . : . : . : . : . :
JMFS145C07- GCTGGTGCAATTGCAGTTAGACGGGTTCGTAAGGAAGATTTGCGTCATGTTGCCAAGGCT
                      ____________________________________________________________
consensus GCTGGTGCAATTGCAGTTAGACGGGTTCGTAAGGAAGATTTGCGTCATGTTGCCAAGGCT
 
. : . : . : . : . : . :
JMFS145C07- ACTGGTGCAACTGTGGTCTCAACATTTGCAGATATGGAAGGAGAAGAAACATTTGAAGCG
rJMSF052C06+ TGGTGCAACTGTGGTCTCAACATTTGCAGATATGGAAGGAGAAGAAACATTTGAAGCG
                      ____________________________________________________________
consensus ACTGGTGCAACTGTGGTCTCAACATTTGCAGATATGGAAGGAGAAGAAACATTTGAAGCG
 
. : . : . : . : . : . :
JMFS145C07- TCACTCCTTGGACAGGCAGAAGAGGTTGTTGAGGAGCGCATTGCTGATGACGATGTTATT
rJMFF012A17+ GGACAGGCAGAAGAGGTTGTTGAGGAGCGCATTGCTGATGACGATGTTATT
rJMSF029G02+ GTTGAGGAGCGCATTGCTGATGACGATGTTATT
rJMSF019H12+ GGACAGGCAGAAGAGGTTGTTGAGGAGCGCATTGCTGATGACGATGTTATT
rJMFF037N03+ GGAGCGCATTGCTGATGACGATGTTATT
rJMSF052C06+ TCACTCCTTGGACAGGCAGAAGAGGTTGTTGAGGAGCGCATTGCTGATGACGATGTTATT
                      ____________________________________________________________
consensus TCACTCCTTGGACAGGCAGAAGAGGTTGTTGAGGAGCGCATTGCTGATGACGATGTTATT
 
. : . : . : . : . : . :
JMFS145C07- ATGATTAAAGGGACTAAAACCACTAGTGCGGTTTCAGTGATACTTAGGGGAGCAAATGAC
rJMFF012A17+ ATGATTAAAGGGACTAAAACCACTAGTGCGGTTTCAGTGATACTTAGGGGAGCAAATGAC
rJMSF029G02+ ATGATTAAAGGGACTAAAACCACTAGTGCGGTTTCAGTGATACTTAGGGGAGCAAATGAC
rJMSF019H12+ ATGATTAAAGGGACTAAAACCACTAGTGCGGTTTCAGTGATACTTAGGGGAGCAAATGAC
rJMFF037N03+ ATGATTAAAGGGACTAAAACCACTAGTGCGGTTTCAGTGATACTTAGGGGAGCAAATGAC
rJMSF052C06+ ATGATTAAAGGGACTAAAACCACTAGTGCGGTTTCAGTGATACTTAGGGGAGCAAATGAC
rJMFF029K01+ CACTAGTGCGGTTTCAGTGATACTTAGGGGAGCAAATGAC
rJMSF002F16+ GACTAAANCCACTAGTGCGGTTTCAGTGATACTTAGGGGAGCAAATGAC
                      ____________________________________________________________
consensus ATGATTAAAGGGACTAAAACCACTAGTGCGGTTTCAGTGATACTTAGGGGAGCAAATGAC
 
. : . : . : . : . : . :
JMFS145C07- TTTATGCTTGATGAGATGGAGAGGGCCCTGCATGACTCTTTATGCATTGTTAAGAGAACA
rJMFF012A17+ TTTATGCTTGATGAGATGGAGAGGGCCCTGCATGACTCTTTATGCATTGTTAAGAGAACA
rJMSF029G02+ TTTATGCTTGATGAGATGGAGAGGGCCCTGCATGACTCTTTATGCATTGTTAAGAGAACA
rJMSF019H12+ TTTATGCTTGATGAGATGGAGAGGGCCCTGCATGACTCTTTATGCATTGTTAAGAGAACA
rJMFF037N03+ TTTATGCTTGATGAGATGGAGAGGGCCCTGCATGACTCTTTATGCATTGTTAAGAGAACA
rJMSF052C06+ TTTATGCTTGATGAGATGGAGAGGGCCCTGCATGACTCTTTATGCATTGTTAAGAGAACA
rJMFF029K01+ TTTATGCTTGATGAGATGGAGAGGGCCCTGCATGACTCTTTATGCATTGTTAAGAGAACA
rJMSF002F16+ TTTATGCTTGATGAGATGGAGAGGGCCCTGCATGACTCTTTATGCATTGTTAAGAGAACA
                      ____________________________________________________________
consensus TTTATGCTTGATGAGATGGAGAGGGCCCTGCATGACTCTTTATGCATTGTTAAGAGAACA
 
. : . : . : . : . : . :
JMFS145C07- TTAGAATCCACAACTGTTGTTGCTGGTGGAGGTGCTGTTGAGTCTGCCTTATCAGTTTAC
rJMFF012A17+ TTAGAATCCACAACTGTTGTTGCTGGTGGAGGTGCTGTTGAGTCTGCCTTATCAGTTTAC
rJMSF029G02+ TTAGAATCCACAACTGTTGTTGCTGGTGGAGGTGCTGTTGAGTCTGCCTTATCAGTTTAC
rJMSF019H12+ TTAGAATCCACAACTGTTGTTGCTGGTGGAGGTGCTGTTGAGTCTGCCTTATCAGTTTAC
rJMFF037N03+ TTAGAATCCACAACTGTTGTTGCTGGTGGAGGTGCTGTTGAGTCTGCCTTATCAGTTTAC
rJMSF052C06+ TTAGAATCCACAACTGTTGTTGCTGGTGGAGGTGCTGTTGAGTCTGCCTTATCAGTTTAC
rJMFF029K01+ TTAGAATCCACAACTGTTGTTGCTGGTGGAGGTGCTGTTGAGTCTGCCTTATCAGTTTAC
rJMFF028J13+ CCACAACTGTTGTTGCTGGTGGAGGTGCTGTTGAGTCTGCCTTATCAGTTTAC
rJMSF002F16+ TTAGAATCCACAACTGTTGTTGCTGGTGGAGGTGCTGTTGAGTCTGCCTTATCAGTTTAC
                      ____________________________________________________________
consensus TTAGAATCCACAACTGTTGTTGCTGGTGGAGGTGCTGTTGAGTCTGCCTTATCAGTTTAC
 
. : . : . : . : . : . :
JMFS145C07- CTGGAGTACCTTGCAACTACACTTGGATCTCGGGAGCAACTGGCAATTGCTGAATTTGCC
rJMFF012A17+ CTGGAGTACCTTGCAACTACACTTGGATCTCGGGAGCAACTGGCAATTGCTGAATTTGCC
rJMSF029G02+ CTGGAGTACCTTGCAACTACACTTGGATCTCGGGAGCAACTGGCAATTGCTGAATTTGCC
rJMSF019H12+ CTGGAGTACCTTGCAACTACACTTGGATCTCGGGAGCAACTGGCAATTGCTGAATTTGCC
rJMFF037N03+ CTGGAGTACCTTGCAACTACACTTGGATCTCGGGAGCAACTGGCAATTGCTGAATTTGCC
rJMSF052C06+ CTGGAGTACCTTGCAACTACACTTGGATCTCGGGAGCAACTGGCAATTGCTGAATTTGCC
rJMFF029K01+ CTGGAGTACCTTGCAACTACACTTGGATCTCGGGAGCAACTGGCAATTGCTGAATTTGCC
rJMFF028J13+ CTGGAGTACCTTGCAACTACACTTGGATCTCGGGAGCAACTGGCAATTGCTGAATTTGCC
rJMFF044A21+ GTACCTTGCAACTACACTTGGATCTCGGGAGCAACTGGCAATTGCTGAATTTGCC
rJMSF002F16+ CTGGAGTACCTTGCAACTACACTTGGATCTCGGGAGCAACTGGCAATTGCTGAATTTGCC
                      ____________________________________________________________
consensus CTGGAGTACCTTGCAACTACACTTGGATCTCGGGAGCAACTGGCAATTGCTGAATTTGCC
 
. : . : . : . : . : . :
JMFS145C07- GAATCCTTATTGATCATTCCAAAGGTACTTGCTGTCAATGCTGCTAAGGATTCGACCGAG
rJMFF012A17+ GAATCCTTATTGATCATTCCAAAGGTACTTGCTGTCAATGCTGCTAAGGATTCGACCGAG
rJMSF029G02+ GAATCCTTATTGATCATTCCAAAGGTACTTGCTGTCAATGCTGCTAAGGATTCGACCGAG
rJMSF019H12+ GAATCCTTATTGATCATTCCAAAGGTACTTGCTGTCAATGCTGCTAAGGATTCGACCGAG
rJMFF037N03+ GAATCCTTATTGATCATTCCAAAGGTACTTGCTGTCAATGCTGCTAAGGATTCGACCGAG
rJMSF052C06+ GAATCCTTATTGATCATTCCAAAGGTACTTGCTGTCAATGCTGCTAAGGATTCGACCGAG
rJMFF029K01+ GAATCCTTATTGATCATTCCAAAGGTACTTGCTGTCAATGCTGCTAAGTATTCGACCGAG
rJMFF028J13+ GAATCCTTATTGATCATTCCAAAGGTACTTGCTGTCAATGCTGCTAAGGATTCGACCGAG
rJMFF044A21+ GAATCCTTATTGATCATTCCAAAGGTACTTGCTGTCAATGCTGCTAAGGATTCGACCGAG
rJMSF002F16+ GAATCCTTATTGATCATTCCAAAGGTACTTGCTGTCAATGCTGCTAAGGATTCGACCGAG
                      ____________________________________________________________
consensus GAATCCTTATTGATCATTCCAAAGGTACTTGCTGTCAATGCTGCTAAGGATTCGACCGAG
 
. : . : . : . : . : . :
JMFS145C07- TTGGTTTCTCAATTACGTGCACATCACCATTATGCA
rJMFF012A17+ TTGGTTTCTCAATTACGTGCACATCACCATTATGCACAAACACAGGCAGATAAGAAACAT
rJMSF029G02+ TTGGTTTCTCAATTACGTGCACATCACCATTATGCACAAACACAGGCAGATAAGAAACAT
rJMSF019H12+ TTGGTTTCTCAATTACGTGCACATCACCATTATGCACAAACACAGGCAGATAAGAAACAT
rJMFF037N03+ TTGGTTTCTCAATTACGTGCACATCACCATTATGCACAAACACAGGCAGATAAGAAACAT
rJMSF052C06+ TTGGTTTCTCAATTACGTGCACATCACCATTATGCACAAACACAGGCAGATAAGAAACAT
rJMFF029K01+ TTGGTTTCTCAATTACGTGCACATCACCATTATGCACAAACACAGGCAGATAAGAAACAT
rJMFF028J13+ TTGGTTTCTCAATTACGTGCACATCACCATTATGCACAAACACAGGCAGATAAGAAACAT
rJMFF044A21+ TTGGTTTCTCAATTACGTGCACATCACCATTATGCACAAACACAGGCAGATAAGAAACAT
rJMSF002F16+ TTGGTTTCTCAATTACGTGCACATCACCATTATGCACAAACACAGGCAGATAAGAAACAT
                      ____________________________________________________________
consensus TTGGTTTCTCAATTACGTGCACATCACCATTATGCACAAACACAGGCAGATAAGAAACAT
 
. : . : . : . : . : . :
rJMFF012A17+ TGGTCGAGCATGGGACTAGACCTAGTGAAGGGAATCGTACGTAACAACTTGGAAGCTGGA
rJMSF029G02+ TGGTCGAGCATGGGACTAGACCTAGTGAAGGGAATTGTACGTAACAACTTGGAAGCTGGA
rJMSF019H12+ TGGTCGAGCATGGGACTAGACCTAGTGAAGGGAATCGTACGTAACAACTTGGAAGCTGGA
rJMFF037N03+ TGGTCGAGCATGGGACTAGACCTAGTGAAGGGAATCGTACGTAACAACTTGGAAGCTGGA
rJMSF052C06+ TGGTCGAGCATGGGACTAGACCTAGTGAAGGGAATCGTACGTAACAACTTGGAAGCTGGA
rJMFF029K01+ TGGTCGAGCATGGGACTAGACCTAGTGAAGGGAATCGTACGTAACAACTTGGAAGCTGGA
rJMFF028J13+ TGGTCGAGCATGGGACTAGACCTAGTGAAGGGAATCGTACGTAACAACTTGGAAGCTGGA
rJMFF044A21+ TGGTCGAGCATGGGACTAGACCTAGTGAAGGGAATCGTACGTAACAACTTGGAAGCTGGA
rJMSF002F16+ TGGTCGAGCATGGGACTAGACCTAGTGAAGGGAATCGTACGTAACAACTTGGAAGCTGGA
                      ____________________________________________________________
consensus TGGTCGAGCATGGGACTAGACCTAGTGAAGGGAATCGTACGTAACAACTTGGAAGCTGGA
 
. : . : . : . : . : . :
rJMFF012A17+ GTAATTGAGCCTGCTATGAGTAAAGTGAAGATAATCCAATTTGCAACTGAAGCTGCTATC
rJMSF029G02+ GTAATTGAGCCTGCTATGAGTAAAGTGAAGATAATCCAATTTGCAACTGAAGCTGCTATC
rJMSF019H12+ GTAATTGAGCCTGCTATGAGTAAAGTGAAGATAATCCAATTTGCAACTGAAGCTGCTATC
rJMFF037N03+ GTAATTGAGCCTGCTATGAGTAAAGTGAAGATAATCCAATTTGCAACTGAAGCTGCTATC
rJMSF052C06+ GTAATTGAGCCTGCTATGAGTAAAGTGAAGATAATCCAATTTGCAACTGAAGCTGCTATC
rJMFF029K01+ GTAATTGAGCCTGCTATGAGTAAAGTGAAGATAATCCAATTTGCAACTGAAGCTGCTATC
rJMFF028J13+ GTAATTGAGCCTGCTATGAGTAAAGTGAAGATAATCCAATTTGCAACTGAAGCTGCTATC
rJMFF044A21+ GTAATTGAGCCTGCTATGAGTAAAGTGAAGATAATCCAATTTGCAACTGAAGCTGCTATC
rJMSF002F16+ GTAATTGAGCCTGCTATGAGTAAAGTGAAGATAATCCAATTTGCAACTGAAGCTGCTATC
                      ____________________________________________________________
consensus GTAATTGAGCCTGCTATGAGTAAAGTGAAGATAATCCAATTTGCAACTGAAGCTGCTATC
 
. : . : . : . : . : . :
rJMFF012A17+ ACAATTCTTCGAATCGACGACATGATAAAGCTCTTCAAAGATGAAAGTCAGAATGAGGAA
rJMSF029G02+ ACAATTCTTCGAATCGACGACATGATAAAGCTCTTCAAAGATGAAAGTCAGAATGAGGAA
rJMSF019H12+ ACAATTCTTCGAATCGACGACATGATAAAGCTCTTCAAAGATGAAAGTCAGAATGAGGAA
rJMFF037N03+ ACAATTCTTCGAATCGACGACATGATAAAGCTCTTCAAAGATGGAAGTCAGAATGAGGAA
rJMSF052C06+ ACAATTCTTCGAATCGACGACATGATAAAGCTCTTCAAAGATGAAAGTCAGAATGAGGAA
rJMFF029K01+ ACAATTCTTCGAATCGACGACATGATAAAGCTCTTCAAAGATGAAAGTCAGAATGAGGAA
rJMFF028J13+ ACAATTCTTCGAATCGACGACATGATAAAGCTCTTCAAAGATGAAAGTCAGAATGAGGAA
rJMFF044A21+ ACAATTTTTCGAATCGACGACATGATAAAGCTCTTCAAAGATGAAAGTCAGAATGAGGAA
rJMSF002F16+ ACAATTCTTCGAATCGACGACATGATAAAGCTCTTCAAAGATGAAAGTCAGAATGAGGAA
                      ____________________________________________________________
consensus ACAATTCTTCGAATCGACGACATGATAAAGCTCTTCAAAGATGAAAGTCAGAATGAGGAA
 
. : . : . : . : . : . :
rJMFF012A17+ TAGGGTTATATATTTTCACAGTTTCTGAACGAGTAAGTTGATGATTCGTAGGGGAGATGT
rJMSF029G02+ TAGGGTTATATATTTTCACAGTTTCTGAACGAGTAAGTTGATGATTCGTAGGGGAGATGT
rJMSF019H12+ TAGGGTTATATATTTTCACAGTTTCTGAACGAGTAAGTTGATGATTCGTAGGGGAGATGT
rJMFF037N03+ TAGGGTTATATATTTTCACAGTTTCTGAACGAGTAAGTTGATGATTCGTAGGGGAGATGT
rJMSF052C06+ TAGGGTTATATATTTTCACAGTTTCTGAACGAGTAAGTTGATGATTCGTAGGGGAGATGT
rJMFF029K01+ TAGGGTTATATATTTTCACAGTTTCTGAACGAGTAAGTTGATGATTCGTAGGGGAGATGT
rJMFF028J13+ TAGGGTTATATATTTTCACAGTTTCTGAACGAGTAAGTTGATGATTCGTAGGGGAGATGT
rJMFF044A21+ TAGGGTTATATATTTTCACAGTTTCTGAACGAGTAAGTTGATGATTCGTAGGGGAGATGT
rJMSF002F16+ TAGGGTTATATATTTTCACAGTTTCTGAACGAGTAAGTTGATGATTCGTAGGGGAGATGT
                      ____________________________________________________________
consensus TAGGGTTATATATTTTCACAGTTTCTGAACGAGTAAGTTGATGATTCGTAGGGGAGATGT
 
. : . : . : . : . : . :
rJMFF012A17+ AACATTGCCATCCATTTGATTTGTGAGCCGTGAAATGATGTTTCCCAGGCTGCCTGCTTG
rJMSF029G02+ AACATTGCCATCCATTTGATTTGTGAGCCGTGAAATGATGTTTCCCAGGCTGCCTGCTTG
rJMSF019H12+ AACATTGCCATCCATTTGATTTGTGAGCCGTGAAATGATGTTTCCCAGGCTGCCTGCTTG
rJMFF037N03+ AACATTGCCATCCATTTGATTTGTGAGCCGTGAAATGATGTTTCCCAGGCTGCCTGCTTG
rJMSF052C06+ AACATTGCCATCCATTTGATTTGTGAGCCGTGAAATGATGTTTCCCAGGCTGCCTGCTTG
rJMFF029K01+ AACATTGCCATCCATTTGATTTGTGAGCCGTGAAATGATGTTTCCCAGGCTGCCTGCTTG
rJMFF028J13+ AACATTGCCATCCATTTGATTTGTGAGCCGTGAAATGATGTTTCCCAGGCTGCCTGCTTG
rJMFF044A21+ AACATTGCCATCCATTTGATTTGTGAGCCGTGAAATGATGTTTCCCAGGCTGCCTGCTTG
rJMSF002F16+ AACATTGCCATCCATTTGATTTGTGAGCCGTGAAATGATGTTTCCCAGGCTGCCTGCTTG
                      ____________________________________________________________
consensus AACATTGCCATCCATTTGATTTGTGAGCCGTGAAATGATGTTTCCCAGGCTGCCTGCTTG
 
. : . : . : . : . : . :
rJMFF012A17+ -TTTATTCTGAACTTGTGTGATTGTGATACAAAGACTTTAATCCACTGTCAGCAAATTTT
rJMSF029G02+ TTTTATTCTGAACTTGTGTGATTGTGATACAAAGACTTTAATCCAC-GTCAGCAAATTT
rJMSF019H12+ TTTTATTCTGAACTTGTGTGATTGTGATACAAAGACTTTAATCCACTGTCAGCAAATTT
rJMFF037N03+ TTTTATTCTGAACTTGTGTGATTGTGATACAAAGACTTTAATCCACTGTCAGCAAATTTT
rJMSF052C06+ TTTTATTCTGAACTTGTGTGATTGTGATACAAAGACTTTAATCCACTGTCAGCAAATTTT
rJMFF029K01+ TTTTATTCTGAACTTGTGTGATTGTGATACAAAGACTTTAATCCACTGTCAGCAAATTTT
rJMFF028J13+ TTTTATTCTGAACTTGTGTGATTGTGATACAAAGACTTTAATCCACTGTCAGCAAATTTT
rJMFF044A21+ TTTTATTCTGAACTTGTGTGATTGTGATACAAAGACTTTAATCCACTGTCAGCAAATTTT
rJMSF002F16+ TTTTATTCTGAACTTGTGTGATTGTGATACAAAGACTTTAATCCACTGTCAGCAAATTTT
                      ____________________________________________________________
consensus TTTTATTCTGAACTTGTGTGATTGTGATACAAAGACTTTAATCCACTGTCAGCAAATTTT
 
. : . : . : . : . : . :
rJMFF012A17+ GAAGTACTCTTAACTTTATTTGTA-GAAAAACCAAG
rJMFF037N03+ GAAGTACTCTTAAC
rJMSF052C06+ GAAGTACTCTTAACTTTATTTGTATGAAAAACCAAGTATTCGCAATTTCTAAGCCGTT
rJMFF029K01+ GAAGTACTCTTAACTTTATTTGTATGAAAAACCAAGTATTCGCAATT
rJMFF028J13+ GAAGTACTCTTAACTTTATTTGTA-GAAAAACCAAG
rJMFF044A21+ GAAGTACTCTTAACTTTATTTGTATGAAAAACCAAGTATTCGCAATT
rJMSF002F16+ GAAGTACTCTTAACTTTATTTGTATGAAAAACCAAGTATTCGCAATTTCTAAGCCGTTCC
                      ____________________________________________________________
consensus GAAGTACTCTTAACTTTATTTGTATGAAAAACCAAGTATTCGCAATTTCTAAGCCGTTCC