Previous Contig 011202:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002F01Sequence420018263pir|T48133|T481331e-24hypothetical protein T4C9.70 - Arabidopsis thaliana>gb:ATCHRIV33_1544988 Arabido675011202 (4)gb:AE016959_10211446e-29Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC09
JMSF040D13Sequence657020054pir|T48133|T481334e-30hypothetical protein T4C9.70 - Arabidopsis thaliana>gb:ATCHRIV33_1544988 Arabido826011202 (4)pir|T48133|T481332e-51hypothetical protein T4C9.70 - Arabidopsis thaliana>gb:ATCHRIV33_1544988 Arabido
JMSF048E20Sequence702011202 (4)pir|T48133|T481332e-83hypothetical protein T4C9.70 - Arabidopsis thaliana>gb:ATCHRIV33_1544988 Arabido731011202 (4)pir|T48133|T481332e-44hypothetical protein T4C9.70 - Arabidopsis thaliana>gb:ATCHRIV33_1544988 Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF048E20- GGC
                      ____________________________________________________________
consensus GGC
 
. : . : . : . : . : . :
JMSF048E20- ACCATCTCGAATAATTTGCAGACAGAAGATCAATCGTACTGCTCGAAAACCAGATTTTGC
                      ____________________________________________________________
consensus ACCATCTCGAATAATTTGCAGACAGAAGATCAATCGTACTGCTCGAAAACCAGATTTTGC
 
. : . : . : . : . : . :
JMSF048E20- AATCGGGAGCTATGGTTTCCTTCAAGCTTTTATAGGTAATGGTTTGGCGCAGAGAAATAA
                      ____________________________________________________________
consensus AATCGGGAGCTATGGTTTCCTTCAAGCTTTTATAGGTAATGGTTTGGCGCAGAGAAATAA
 
. : . : . : . : . : . :
JMSF048E20- GGGGTTAAGAATCAGCAATGAAAGGCGTCTTCTCGGCGCCCGGTGATTACATCTACTTCA
                      ____________________________________________________________
consensus GGGGTTAAGAATCAGCAATGAAAGGCGTCTTCTCGGCGCCCGGTGATTACATCTACTTCA
 
. : . : . : . : . : . :
JMSF048E20- AGTCTCAGATTGGGTCGAAGCAGTGGCGCTATTATGATTTTGGCCCTAAAGTGGTTCCTC
                      ____________________________________________________________
consensus AGTCTCAGATTGGGTCGAAGCAGTGGCGCTATTATGATTTTGGCCCTAAAGTGGTTCCTC
 
. : . : . : . : . : . :
JMSF048E20- CACTCATCTGTCTTCCTGGCATAGCGGGAACGGCTGATGTATATTACAAGCAGATCATGT
                      ____________________________________________________________
consensus CACTCATCTGTCTTCCTGGCATAGCGGGAACGGCTGATGTATATTACAAGCAGATCATGT
 
. : . : . : . : . : . :
JMSF048E20- CATTGTCCATGAAGGGTTATCGCGTGATTTCTGTTGATATTGCCCGTGCATGGAACCATC
                      ____________________________________________________________
consensus CATTGTCCATGAAGGGTTATCGCGTGATTTCTGTTGATATTGCCCGTGCATGGAACCATC
 
. : . : . : . : . : . :
JMSF048E20- ATGAATGGGTTCAAGCATTTGAGAAGTTTCTAGATGCTATTGATGTTCACCATATACATC
                      ____________________________________________________________
consensus ATGAATGGGTTCAAGCATTTGAGAAGTTTCTAGATGCTATTGATGTTCACCATATACATC
 
. : . : . : . : . : . :
JMSF048E20- TATATGGTACAGCACTCGGAGGATTCTTAGCACAACTATTTGCTCAGCATCGTCCACGTC
                      ____________________________________________________________
consensus TATATGGTACAGCACTCGGAGGATTCTTAGCACAACTATTTGCTCAGCATCGTCCACGTC
 
. : . : . : . : . : . :
JMSF048E20- GTGTTAGGTCGTTGGTACTTTCAAACACTTTTTTGGAGACAACTAGTTTTGCTGCTGCTA
                      ____________________________________________________________
consensus GTGTTAGGTCGTTGGTACTTTCAAACACTTTTTTGGAGACAACTAGTTTTGCTGCTGCTA
 
. : . : . : . : . : . :
JMSF048E20- TGCCATGGGCTCCTGTTGTTGCTTGGACACCGTCTTTTCTACTGAAGCGGTATGTCCTGA
rJMSF040D13+ ACTGAAGCGGTATGTCCTGA
                      ____________________________________________________________
consensus TGCCATGGGCTCCTGTTGTTGCTTGGACACCGTCTTTTCTACTGAAGCGGTATGTCCTGA
 
. : . : . : . : . : . :
JMSF048E20- CTGGAATCA-GGGATGTCCCGCAAGAACCTTTTATTGCAGATTCTGTGGATTTTGTTGTT
rJMSF048E20+ GTT
rJMSF040D13+ CTGGAATCAGGGGATGTCCCGCAAGAACCTTTTATTGCAGATTCTGTGGATTTTGTTGTT
                      ____________________________________________________________
consensus CTGGAATCAGGGGATGTCCCGCAAGAACCTTTTATTGCAGATTCTGTGGATTTTGTTGTT
 
. : . : . : . : . : . :
JMSF048E20- TCCCAGGTTGAAGCACTCGCTAAAGATGACCTGGCATCCA
rJMSF048E20+ TCCCAGGTTGAAGCACTCGCTAAAGATGACCTGGCATCCAGATTAACATTGACGGCAGAT
rJMSF040D13+ TCCCAGGTTGAAGCACTCGCTAAAGATGACCTGGCATCCAGATTNACATTGACGGCAGAT
                      ____________________________________________________________
consensus TCCCAGGTTGAAGCACTCGCTAAAGATGACCTGGCATCCAGATTAACATTGACGGCAGAT
 
. : . : . : . : . : . :
rJMSF048E20+ GCTGCATCAGTTGGACCTCTTCTCCTTCCAGATTCTTCTATCACCCTTATGGATACGAAT
rJMSF040D13+ GCTGCATCAGTTGGACCTCTTCTCCTTCCAGATTCTTCTATCACCCTTATGGATACGAAT
rJMSF002F01+ CTTATGGATACGAAT
                      ____________________________________________________________
consensus GCTGCATCAGTTGGACCTCTTCTCCTTCCAGATTCTTCTATCACCCTTATGGATACGAAT
 
. : . : . : . : . : . :
rJMSF048E20+ GATTACTGTGCGACCCCACAACAGCTCAAAGATCAAGTTAGAGAAAGGTACCCCGGTGCC
rJMSF040D13+ GATTACTGTGCGACCCCACAACAGCTCAAAGATCAAGTTAGAGAAAGGTACCCCGGTGCC
rJMSF002F01+ GATTACTGTGCGACCCCACAACAGCTCAAAGATCAAGTTAGAGAAAGGTACCCCGGTGCC
                      ____________________________________________________________
consensus GATTACTGTGCGACCCCACAACAGCTCAAAGATCAAGTTAGAGAAAGGTACCCCGGTGCC
 
. : . : . : . : . : . :
rJMSF048E20+ CGACAAGCAATCTTGAAGACTGGAGGTGATTTTCCCTTTCTTTCTCGGCCCGATGAAGTG
rJMSF040D13+ CGACAAGCAATCTTGAAGACTGGAGGTGATTTTCCCTTTCTTTCTCGGCCCGATGAAGTG
rJMSF002F01+ CGACAAGCAATCTTGAAGACTGGAGGTGATTTTCCCTTTCTTTCTCGGCCCGATGAAGTG
                      ____________________________________________________________
consensus CGACAAGCAATCTTGAAGACTGGAGGTGATTTTCCCTTTCTTTCTCGGCCCGATGAAGTG
 
. : . : . : . : . : . :
rJMSF048E20+ AACCTTCATCTTCAGCTACACCTGAGACGAGTTGGTGTTGAGGCACGACCAGACTTGGTT
rJMSF040D13+ AACCTTCATCTTCAGCTACACNTGAGACGAGTTGGTGTTGAGGCACGACCAGACTTGGTT
rJMSF002F01+ AACCTTCATCTTCAGCTACACCTGAGACGAGTTGGTGTTGAGGCACGACCAGACTTGGTT
                      ____________________________________________________________
consensus AACCTTCATCTTCAGCTACACCTGAGACGAGTTGGTGTTGAGGCACGACCAGACTTGGTT
 
. : . : . : . : . : . :
rJMSF048E20+ AGGAGCGTTCCCCGGGATGGCAATGGCGAAAGTTCGGATGGACCTAAAGACGAGAGAGGA
rJMSF040D13+ AGGAGCGTTCCCCGGGATGGCAATGGNGAAAGTTCGGATGGACCTAAAGACGAGAGAGGA
rJMSF002F01+ AGGAGCGTTCCCCGGGATGGCAATGGCGAAAGTTCGGATGGACCTAAAGACGAGAGAGGA
                      ____________________________________________________________
consensus AGGAGCGTTCCCCGGGATGGCAATGGCGAAAGTTCGGATGGACCTAAAGACGAGAGAGGA
 
. : . : . : . : . : . :
rJMSF048E20+ GATTCTGATGATGGGTCAAAAGACGACGATGCTAATCACTCAGAAAGCCCTTCCCACACG
rJMSF040D13+ GATTCTGATGATGGGTCAAAAGACGACGATGCTAATCACTCAGAAAGCCCTTCCCACACG
rJMSF002F01+ GATTCTGATGATGGGTCAAAAGACGACGATGCTAATCACTCAGAAAGCCCTTCCCACACG
                      ____________________________________________________________
consensus GATTCTGATGATGGGTCAAAAGACGACGATGCTAATCACTCAGAAAGCCCTTCCCACACG
 
. : . : . : . : . : . :
rJMSF048E20+ GACGAACCACCGTTCGCTCCGGGAGGTACCGATCCACCATTGACACCACAAGGTACGCAT
rJMSF040D13+ GACGAACCACCGTTCGCTCCGGGAGGTACCGATCCACCATTGACACCACAAGGTACGCAT
rJMSF002F01+ GACGAACCACCGTTCGCTCCGGGAGGTACCGATCCACCATTGACACCACAAGGTACGCAT
                      ____________________________________________________________
consensus GACGAACCACCGTTCGCTCCGGGAGGTACCGATCCACCATTGACACCACAAGGTACGCAT
 
. : . : . : . : . : . :
rJMSF048E20+ TCTCATACACTAGCGAATCACTCGAGAATTTCCAAAAGCGAGCAACTTTCAAACGCGTTT
rJMSF040D13+ TCTCATACACTAGCGAATCACTCGAGAATTTCCAAAAGCGAGCAACTTTCAAACGCGTTT
rJMSF002F01+ TCTCATACACTAGCGAATCACTCGAGAATTTCCAAAAGCGAGCAACTTTCAAACGCGTTT
                      ____________________________________________________________
consensus TCTCATACACTAGCGAATCACTCGAGAATTTCCAAAAGCGAGCAACTTTCAAACGCGTTT
 
. : . : . : . : . : . :
rJMSF048E20+ TCTGAAACCGAGCTAAACATGGCATCTCGAGTCTTGTTACACTTCATCCATCGTCTGCTT
rJMSF040D13+ TCTGAAACCGAGCTAAACATGGCATCTCGAGTCTTGTTACACTTCATCCATCGTCTGCTT
rJMSF002F01+ TCTGAAACCGAGCTAAACATGGCATCTCGAGTCTTGTTACACTTCATCCATCGTCTGCTT
                      ____________________________________________________________
consensus TCTGAAACCGAGCTAAACATGGCATCTCGAGTCTTGTTACACTTCATCCATCGTCTGCTT
 
. : . : . : . : . : . :
rJMSF048E20+ CCCCTCTACCTCGGGGCATTTTGCGCTAATTCAAAGCATTGCTTGGAATTTAGAAACTTA
rJMSF040D13+ CCCCTCTACCTCGGGGCATTTTGCGCTAATTCAAAGCATTGCTTGGAATTTAGAAACTTA
rJMSF002F01+ CCCCTCTACCTCGGGGCATTTTGCGCTAATTCAAAGCATTGCTTGGAATTTAGAAACTTA
                      ____________________________________________________________
consensus CCCCTCTACCTCGGGGCATTTTGCGCTAATTCAAAGCATTGCTTGGAATTTAGAAACTTA
 
. : . : . : . : . : . :
rJMSF048E20+ GTATAGAGGAATTTCTTTGTAAATTATGGTTTTTTTTGTAGACACCA
rJMSF040D13+ GTATAGAGGAATTTCTTTGTAAATTATGGTTTTTTTTGTAGACACCAGAAATGGAAATTG
rJMSF002F01+ GTATAGAGGAATTTCTTTGTAAATTATGGTTTTTTTTGTAGACACCAGAAATGGAAATTG
                      ____________________________________________________________
consensus GTATAGAGGAATTTCTTTGTAAATTATGGTTTTTTTTGTAGACACCAGAAATGGAAATTG
 
. : . : . : . : . : . :
rJMSF040D13+ AATGCTTGAGTTTGTGGTGGAAAGGT
rJMSF002F01+ AATGCTTGAGTTTGTGGTGGAAAGGTTCTTTTTAGTTGAGACAGCTATGCAATGTATCTG
                      ____________________________________________________________
consensus AATGCTTGAGTTTGTGGTGGAAAGGTTCTTTTTAGTTGAGACAGCTATGCAATGTATCTG