Previous Contig 011198:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002D23Sequence395007125 (4)gb:AP004559_18415676e-48Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P046768011198 (2)
JMSF037B14Sequence696007125 (4)gb:AP004559_18415672e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P046665011198 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF002D23+ TCTTGGCAAACTTTCTATATATAATATTCATAAGTACAACTTTGAGTT
                      ____________________________________________________________
consensus TCTTGGCAAACTTTCTATATATAATATTCATAAGTACAACTTTGAGTT
 
. : . : . : . : . : . :
rJMSF037B14+ GGTGTAATTTACAGAAATATGGTGCT
rJMSF002D23+ GTTCTTNGCAGACATCTTTTTAGCCATGCTGGGGGGTGTAATTTACAGAAATATGGTGCT
                      ____________________________________________________________
consensus GTTCTTNGCAGACATCTTTTTAGCCATGCTGGGGGGTGTAATTTACAGAAATATGGTGCT
 
. : . : . : . : . : . :
rJMSF037B14+ TTATAACATATATATGTATTGTTTTTCATCTTCATTTGCCTTTACTGCCCATATTCATGG
rJMSF002D23+ TTATAACATATATATGTATTGTTTTTCATCTTCATTTGCCTTTACTGCCCATATTCATGG
                      ____________________________________________________________
consensus TTATAACATATATATGTATTGTTTTTCATCTTCATTTGCCTTTACTGCCCATATTCATGG
 
. : . : . : . : . : . :
rJMSF037B14+ GAAAAGAGTAAGCAGCATATTTTAGCATTGTAGCATATAAGTTGGTATACACCAGATTAC
rJMSF002D23+ GAAAAGAGTAAGCAGCATATTTTAGCATTGTAGCATATAAGTTGGTATACACCAGATTAC
                      ____________________________________________________________
consensus GAAAAGAGTAAGCAGCATATTTTAGCATTGTAGCATATAAGTTGGTATACACCAGATTAC
 
. : . : . : . : . : . :
rJMSF037B14+ TACACAAGATGGCCTTTAGAAGCAGTTGAAATTTGTGCCATAGCTCTTTCGGCAGCCTAA
rJMSF002D23+ TACACAAGATGGCCTTTAGAAGCAGTTGAAATTTGTGCCATAGCTCTTTCGGCAGCCTAA
                      ____________________________________________________________
consensus TACACAAGATGGCCTTTAGAAGCAGTTGAAATTTGTGCCATAGCTCTTTCGGCAGCCTAA
 
. : . : . : . : . : . :
rJMSF037B14+ TGATACTTGGTCTACTTTTGTTTTATCATTCATTCCTGACTAACTCCTGCTTAAGGGATT
rJMSF002D23+ TGATACTTGGTCTACTTTTGTTTTATCATTCATTCCTGACTAACTCCTGCTTAAGGGATT
                      ____________________________________________________________
consensus TGATACTTGGTCTACTTTTGTTTTATCATTCATTCCTGACTAACTCCTGCTTAAGGGATT
 
. : . : . : . : . : . :
rJMSF037B14+ CTTCTGTGCAGTTTGTTGAATCAAATGAAGCGCTATCTCTAGATAAGAGGTTCGTCCATC
rJMSF002D23+ CTTCTGTGCAGTTTGTTGAATCAAATGAAGCGCTATCTCTAGATAAGAGGTTCGTCCATC
                      ____________________________________________________________
consensus CTTCTGTGCAGTTTGTTGAATCAAATGAAGCGCTATCTCTAGATAAGAGGTTCGTCCATC
 
. : . : . : . : . : . :
rJMSF037B14+ TCTTGAAAAGGATACCTTACTATTGGAGTGTCCCCTACGAGTACAGGCGTTCTTTTGGAC
rJMSF002D23+ TCTTGAAAAGGATACCTTACTATTGGAGTGTCCCCTACGAGTACAGGCGTTCTTTTGGAC
                      ____________________________________________________________
consensus TCTTGAAAAGGATACCTTACTATTGGAGTGTCCCCTACGAGTACAGGCGTTCTTTTGGAC
 
. : . : . : . : . : . :
rJMSF037B14+ GCTGTTTTGGTGTTTTCCATTGCCAAACCTCATTGAAGAATGGAAATGGTACTGTAGATG
rJMSF002D23+ GCTGTTTTGGTGTTTTCCATTGCCAAACCTCATTGAAGAATGGAAATGGTACTGTAGATG
                      ____________________________________________________________
consensus GCTGTTTTGGTGTTTTCCATTGCCAAACCTCATTGAAGAATGGAAATGGTACTGTAGATG
 
. : . : . : . : . : . :
rJMSF037B14+ TCCCTTTCGTCGTATTGATTGCAAATGCTGTTGCCAGACTTTTAAACAACCAACAGATGT
rJMSF002D23+ TCCCTTTCGTCGTATTGATTGCAAATGCTGTTGCCAGACTTTTAAACAACCAACAGATGT
                      ____________________________________________________________
consensus TCCCTTTCGTCGTATTGATTGCAAATGCTGTTGCCAGACTTTTAAACAACCAACAGATGT
 
. : . : . : . : . : . :
rJMSF037B14+ GCAGTTATTTTAGGTTTTGTGTTTAGAGTCTTTAGCTTAAACAGAGATTTGGGGTGCCCC
rJMSF002D23+ GCAGTTATTTTAGGTTTTGTGTTTAGAGTCTTTAGCTTAAACAGAGATTTGGGGTGCCCC
                      ____________________________________________________________
consensus GCAGTTATTTTAGGTTTTGTGTTTAGAGTCTTTAGCTTAAACAGAGATTTGGGGTGCCCC
 
. : . : . : . : . : . :
rJMSF037B14+ CTTGAGATTAGTGCTTCACTGCAACTCACAAAATTTGTGTATTCTGGGAAGAGAATATTC
rJMSF002D23+ CTTGAGATTAGTGCTTCACTGCAACTCACAAAATTTGTGTATTCTGGGAAGAGAATATTC
                      ____________________________________________________________
consensus CTTGAGATTAGTGCTTCACTGCAACTCACAAAATTTGTGTATTCTGGGAAGAGAATATTC
 
. : . : . : . : . : . :
rJMSF037B14+ CCTTGTCCATGTTGGCACTGATGTATTCTGTATC
rJMSF002D23+ CCTTGTCCATGTTGGCACTGATGTATTCTGTATCATCACTGATAGCAGTTATAGATATAT
                      ____________________________________________________________
consensus CCTTGTCCATGTTGGCACTGATGTATTCTGTATCATCACTGATAGCAGTTATAGATATAT