Previous Contig 011193:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002C20Sequence314005186 (5)gb:AF424566_17989054e-13Arabidopsis thaliana AT5g09860/MYH9_7 mRNA, complete cds.>gb:AF428323_1799253 Ar789011193 (4)gb:AF424566_17989051e-15Arabidopsis thaliana AT5g09860/MYH9_7 mRNA, complete cds.>gb:AF428323_1799253 Ar
JMSF010N19Sequence320005186 (5)gb:AF424566_17989052e-12Arabidopsis thaliana AT5g09860/MYH9_7 mRNA, complete cds.>gb:AF428323_1799253 Ar720011193 (4)gb:AF424566_17989058e-39Arabidopsis thaliana AT5g09860/MYH9_7 mRNA, complete cds.>gb:AF428323_1799253 Ar
JMSF028G03Sequence685005186 (5)gb:AF424566_17989052e-87Arabidopsis thaliana AT5g09860/MYH9_7 mRNA, complete cds.>gb:AF428323_1799253 Ar728011193 (4)gb:AF424566_17989054e-22Arabidopsis thaliana AT5g09860/MYH9_7 mRNA, complete cds.>gb:AF428323_1799253 Ar
JMSF040L08Sequence682005186 (5)gb:AF424566_17989052e-77Arabidopsis thaliana AT5g09860/MYH9_7 mRNA, complete cds.>gb:AF428323_1799253 Ar859011193 (4)gb:AF424566_17989055e-40Arabidopsis thaliana AT5g09860/MYH9_7 mRNA, complete cds.>gb:AF428323_1799253 Ar

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF010N19+ CTGGAAGCCCTTGGCTGAAGATATGG
rJMSF040L08+ GACTACTGGAAGCCCTTGGCTGAAGATATGG
                      ____________________________________________________________
consensus GACTACTGGAAGCCCTTGGCTGAAGATATGG
 
. : . : . : . : . : . :
rJMSF010N19+ ACGAATCTGCTGGAATTGAAGCAGAATATCATCACAAAAATAATCGGGTTTATTGTTGGA
rJMSF040L08+ ACGAATCTGCTGGAATTGAAGCAGAATATCATCACAAAAATAATCGGGTTTATTGTTGGA
                      ____________________________________________________________
consensus ACGAATCTGCTGGAATTGAAGCAGAATATCATCACAAAAATAATCGGGTTTATTGTTGGA
 
. : . : . : . : . : . :
rJMSF028G03+ CTGCTAGACAGGATTTGGAAGGATTTTCTCGATTTACAGAACAT
rJMSF010N19+ AAGGTCTCCGGTTTTTCTGCTAGACAGGATTTGGAAGGATTTTCTCGATTTACAGAACAT
rJMSF040L08+ AAGGTCTCCGG-TTTTCTGCTAGACAGGATTTGGAAGGATTTTCTCGATTTACAGAACAT
rJMSF002C20+ TTACAGAACAT
                      ____________________________________________________________
consensus AAGGTCTCCGGTTTTTCTGCTAGACAGGATTTGGAAGGATTTTCTCGATTTACAGAACAT
 
. : . : . : . : . : . :
rJMSF028G03+ GGTATTGAGGGTGTTGTGCCTGTGGAACTTTTGCCTCCAGAGGTGCGGTCAAAATATCAA
rJMSF010N19+ GGTATTGAGGGTGTTGTGCCTGTGGAACTTTTGCCTCCAGAGGTGCGGTCAAAATATCAA
rJMSF040L08+ GGTATTGAGGGTGTTGTGCCTGTGGAACTTTTGCCTCCAGAGGTGCGGTCAAAATATCAA
rJMSF002C20+ GGTATTGAGGGTGTTGTGCCTGTGGAACTTTTGCCTCCAGAGGTGCGGTCAAAATATCAA
                      ____________________________________________________________
consensus GGTATTGAGGGTGTTGTGCCTGTGGAACTTTTGCCTCCAGAGGTGCGGTCAAAATATCAA
 
. : . : . : . : . : . :
rJMSF028G03+ GGTAAACCAAGTGATAGGTCCAAGCGTGCCAAGGAGGAAACAAAAACTTCAGTGCAACAA
rJMSF010N19+ GGTAAACCAAGTGATAGGTCCAAGCGTGCCAAGGAGGAAACAAAAACTTCAGTGCAACAA
rJMSF040L08+ GGTAAACCAA-TGATAGGTCCAAGCGTGCCAAGGAGGAAACAAAAACTTCAGTGCAACAA
rJMSF002C20+ GGTAAACCAAGTGATAGGTCCAAGCGTGCCAAGGAGGAAACAAAAACTTCAGTGCAACAA
                      ____________________________________________________________
consensus GGTAAACCAAGTGATAGGTCCAAGCGTGCCAAGGAGGAAACAAAAACTTCAGTGCAACAA
 
. : . : . : . : . : . :
rJMSF028G03+ GCAGAAGAAAATCAGGTCGCAACACCTGCTAGTGAGGTATGCATCGAAGGCGGCAAGGCT
rJMSF010N19+ GCAGAAGAAAATCAGGTCGCAACACCTGCTAGTGAGGTATGCATCGAAGGCGGCAAGGCT
rJMSF040L08+ GCAGAAGAAAATCAGGTCGCAACACCTGCTAGTGAGGTATGCATCGAAGGCGGCAAGGCT
rJMSF002C20+ GCAGAAGAAAATCAGGTCGCAACACCTGCTAGTGAGGTATGCATCGAAGGCGGCAAGGCT
                      ____________________________________________________________
consensus GCAGAAGAAAATCAGGTCGCAACACCTGCTAGTGAGGTATGCATCGAAGGCGGCAAGGCT
 
. : . : . : . : . : . :
rJMSF028G03+ GACCTTGAAACCTCTGCTACTCCAATGGACACAGATGCTACCGGGAACATTTCTCAAAGT
rJMSF010N19+ GACCTTGAAACCTCTGCTACTCCAATGGACACAGATGCTACCGGGAACATTTCTCAAAGT
rJMSF040L08+ GACCTTGAAACCTCTGCTACTCCAATGGACACAGATGCTACCGGGAACATTTCTCAAAGT
rJMSF002C20+ GACCTTGAAACCTCTGCTACTCCAATGGACACAGATGCTACCGGGAACATTTCTCAAAGT
                      ____________________________________________________________
consensus GACCTTGAAACCTCTGCTACTCCAATGGACACAGATGCTACCGGGAACATTTCTCAAAGT
 
. : . : . : . : . : . :
rJMSF028G03+ GGAACTCCAACACCAGACGAAAATCAGAAGCAAAGTTCTGACACAGATGTTGGTCAGGAA
rJMSF010N19+ GGAACTCCAACACCAGACGAAAATCAGAAGCAAAGTTCTGACACAGATGTTGGTCAGGAA
rJMSF040L08+ GGAACTCCAACACCAGACGAAAATCAGAAGCAAAGTTCTGACACAGATGTTGGTCAGGAA
rJMSF002C20+ GGAACTCCAACACCAGACGAAAATCAGAAGCAAAGTTCTGACACAGATGTTGGTCAGGAA
                      ____________________________________________________________
consensus GGAACTCCAACACCAGACGAAAATCAGAAGCAAAGTTCTGACACAGATGTTGGTCAGGAA
 
. : . : . : . : . : . :
rJMSF028G03+ GCAGGGCAGATAGAAGCTGATGCAGAAACACAGCAGATTGAAGCAGATGTAGAAGCAGAA
rJMSF010N19+ GCAGGGCAGATAGAAGCTGATGCAGAAACACAGCAGATTGAAGCAGATGTAGAAGCAGAA
rJMSF040L08+ GCAGGGCAGATAGAAGCTGATGCAGAAACACAGCAGATTGAAGCAGATGTAGAAGCAGAA
rJMSF002C20+ GCAGGGCAGATAGAAGCTGATGCAGAAACACAGCAGATTGAAGCAGATGTAGAAGCAGAA
                      ____________________________________________________________
consensus GCAGGGCAGATAGAAGCTGATGCAGAAACACAGCAGATTGAAGCAGATGTAGAAGCAGAA
 
. : . : . : . : . : . :
rJMSF028G03+ GCAGAAGCAGAGGCAGAAGCAGAAGCAGGAACCATCGATGGAGAAACTGGTGACGCTGAC
rJMSF010N19+ GCAGAAGCAGAGGCAGAAGCAGAAGCAGGAACCATCGATGGAGAAACTGGTGACGCTGAC
rJMSF040L08+ GCAGAAGCAGAGGCAGAAGCAGAAGCAGGAACCATCGATGGAGAAACTGGTGACGCTGAC
rJMSF002C20+ GCAGAAGCAGAGGCAGAAGCAGAAGCAGGAACCATCGATGGAGAAACTGGTGACGCTGAC
                      ____________________________________________________________
consensus GCAGAAGCAGAGGCAGAAGCAGAAGCAGGAACCATCGATGGAGAAACTGGTGACGCTGAC
 
. : . : . : . : . : . :
rJMSF028G03+ GCTGATTTAGATGCAGTTGGCTGATTACTACAGGCAGAGGTAGAAGCTGTATCTCGATTT
rJMSF010N19+ GCTGATTTAGATGCAGTTGGCTGATTACTACAGGCAGAGGTAGAAGCTGTATCTCGATTT
rJMSF040L08+ GCTGATTTAGATGCAGTTGGCTGATTACTACAGGCAGAGGTAGAAGCTGTATCTCGATTT
rJMSF002C20+ GCTGATTTAGATGCAGTTGGCTGATTACTACAGGCAGAGGTAGAAGCTGTATCTCGATTT
                      ____________________________________________________________
consensus GCTGATTTAGATGCAGTTGGCTGATTACTACAGGCAGAGGTAGAAGCTGTATCTCGATTT
 
. : . : . : . : . : . :
rJMSF028G03+ GTAATTGATTTTCTTGTGTCATGGAACTTCCGAACTTGCTCTCTTCAAAGAGATTCAGAT
rJMSF010N19+ GTAATTGATTTTCTTGTGTCATGGAACTTCCGAACTTGCTCTCTTCAAAGAGATTCAGAT
rJMSF040L08+ GTAATTGATTTTCTTGTGTCATGGAACTTCCGAACTTGCTCTCTTCAAAGAGATTCAGAT
rJMSF002C20+ GTAATTGATTTTCTTGTGTCATGGAACTTCCGAACTTGCTCTCTTCAAAGAGATTCAGAT
                      ____________________________________________________________
consensus GTAATTGATTTTCTTGTGTCATGGAACTTCCGAACTTGCTCTCTTCAAAGAGATTCAGAT
 
. : . : . : . : . : . :
rJMSF028G03+ CAAACCACGCCCTCTGGGTAAGAGAAGGCTGATCATGATATTCATGCCCATTACGCGGCC
rJMSF010N19+ CAAACCACGCCCTCTGGGTAAGAGAAGGCTGATC
rJMSF040L08+ CAAACCACGCCCTCTGGGTAAGAGAAGGCTGATCATGATATTCATGCCCATTACGCGGCC
rJMSF002C20+ CAAACCACGCCCTCTGGGTAAGAGAAGGCTGATCATGATATTCATGCCCATTACGCGGCC
                      ____________________________________________________________
consensus CAAACCACGCCCTCTGGGTAAGAGAAGGCTGATCATGATATTCATGCCCATTACGCGGCC
 
. : . : . : . : . : . :
rJMSF028G03+ TAATTAATTCTCAATCTTGTCTGTCGCTTTTGAAGCAGTTTTGTTACTCTTCTCATGCTC
rJMSF040L08+ TAATTAATTCTCAATCTTGTCTGTCGCTTTTGAAGCAGTTTTGTTACTCTTCTCATGCTC
rJMSF002C20+ TAATTAATTCTCAATCTTGTCTGTCGCTTTTGAAGCAGTTTTGTTACTCTTCTCATGCTC
                      ____________________________________________________________
consensus TAATTAATTCTCAATCTTGTCTGTCGCTTTTGAAGCAGTTTTGTTACTCTTCTCATGCTC
 
. : . : . : . : . : . :
rJMSF028G03+ CATATGTGATTATTGCATTCAAAC
rJMSF040L08+ CATATGTGATTATTGCATTCAAACGCTGAACCAGACCCTATGAATGAGAT
rJMSF002C20+ CATATGTGATTATTGCATTCAAACGCTGAA-CAGA-CCTATGAATGAGATTGAAGTGTTG
                      ____________________________________________________________
consensus CATATGTGATTATTGCATTCAAACGCTGAACCAGACCCTATGAATGAGATTGAAGTGTTG
 
. : . : . : . : . : . :
rJMSF002C20+ TACTTTTATGATAGAACTTCGTTCTGACATATGAGGAGAATGTAGATGTAGATTAAGATA
                      ____________________________________________________________
consensus TACTTTTATGATAGAACTTCGTTCTGACATATGAGGAGAATGTAGATGTAGATTAAGATA