Previous Contig 011192:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002C15Sequence227011192 (2)gb:AP003263_18266531e-21Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P048743011192 (2)gb:AP003263_18266537e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P048

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF002C15- GAGAGGGGGAATGGAGGACCAAG
rJMSF002C15+ GAGAGGGGGAATGGAGGACCAAG
                      ____________________________________________________________
consensus GAGAGGGGGAATGGAGGACCAAG
 
. : . : . : . : . : . :
JMSF002C15- CAGGAGAAGCAGCTCAGTGCGAAGAGTGCAAATTGCAGCCATGGAAATACAAGTGCCCGG
rJMSF002C15+ CAGGAGAAGCAGCTCAGTGCGAAGAGTGCAAATTGCAGCCATGGAAATACAAGTGCCCGG
                      ____________________________________________________________
consensus CAGGAGAAGCAGCTCAGTGCGAAGAGTGCAAATTGCAGCCATGGAAATACAAGTGCCCGG
 
. : . : . : . : . : . :
JMSF002C15- GATGCTTTCGCCGGACTTGCAGTCTTCCTTGCGTCAAAGCTCACAAAGAGAGGTCCGGTT
rJMSF002C15+ GATGCTTTCGCCGGACTTGCAGTCTTCCTTGCGTCAAAGCTCACAAAGAGAGGTCCGGTT
                      ____________________________________________________________
consensus GATGCTTTCGCCGGACTTGCAGTCTTCCTTGCGTCAAAGCTCACAAAGAGAGGTCCGGTT
 
. : . : . : . : . : . :
JMSF002C15- GCACCGGGAAGAAGCCCTTCAACGACGTCGTTCCCATTTCCCAGTTCGACGATNACCTCC
rJMSF002C15+ GCACCGGGAAGAAGCCCTTCAACGACGTCGTTCCCATTTCCCAGTTCGACGATAACCTCC
                      ____________________________________________________________
consensus GCACCGGGAAGAAGCCCTTCAACGACGTCGTTCCCATTTCCCAGTTCGACGATAACCTCC
 
. : . : . : . : . : . :
JMSF002C15- TATTATCAGATTACAACATGCTAG
rJMSF002C15+ TATTATCAGATTACAACATGCTAGAGGATGTAAAGAGGGTTGCAGATTCTGCTAGAAGAA
                      ____________________________________________________________
consensus TATTATCAGATTACAACATGCTAGAGGATGTAAAGAGGGTTGCAGATTCTGCTAGAAGAA
 
. : . : . : . : . : . :
rJMSF002C15+ TGAGATACAAGCTTTGTGGGTATCCTCAGTTCAGGCTTCCTTTCCCTCTCAAAAGTCTTA
                      ____________________________________________________________
consensus TGAGATACAAGCTTTGTGGGTATCCTCAGTTCAGGCTTCCTTTCCCTCTCAAAAGTCTTA
 
. : . : . : . : . : . :
rJMSF002C15+ GAAGTGCGGCCAATAGCCGGAGGACAAAGCTTCTCTTTCTCTCTGGTGGGATGTCAAAGA
                      ____________________________________________________________
consensus GAAGTGCGGCCAATAGCCGGAGGACAAAGCTTCTCTTTCTCTCTGGTGGGATGTCAAAGA
 
. : . : . : . : . : . :
rJMSF002C15+ GGGAGAAAAACCAAACTTTTTACAACAACAGAAAGAAGTATATATCATGGACTATTGAGT
                      ____________________________________________________________
consensus GGGAGAAAAACCAAACTTTTTACAACAACAGAAAGAAGTATATATCATGGACTATTGAGT
 
. : . : . : . : . : . :
rJMSF002C15+ GGAAATTCCATTCGACTGATGTTGTATTAATGGATCATGGTGTACATGAAAACACAAAGC
                      ____________________________________________________________
consensus GGAAATTCCATTCGACTGATGTTGTATTAATGGATCATGGTGTACATGAAAACACAAAGC
 
. : . : . : . : . : . :
rJMSF002C15+ TGTGCACTTTGATTGAGAAACATCTAGAACCTGGCCCCTGGAAGCATCCACTGAAGCAAT
                      ____________________________________________________________
consensus TGTGCACTTTGATTGAGAAACATCTAGAACCTGGCCCCTGGAAGCATCCACTGAAGCAAT
 
. : . : . : . : . : . :
rJMSF002C15+ TTTGCGAAGTCCCCATGGATTCTCTTAAACTTTTCATCCGGAAATTTCACAAGGTTTTTG
                      ____________________________________________________________
consensus TTTGCGAAGTCCCCATGGATTCTCTTAAACTTTTCATCCGGAAATTTCACAAGGTTTTTG
 
. : . : . : . : . : . :
rJMSF002C15+ TCTTCTAGACATTCTTTGGATGGTTCTATTCTACTTGCGGTCGAATATGCCCACATCCTT
                      ____________________________________________________________
consensus TCTTCTAGACATTCTTTGGATGGTTCTATTCTACTTGCGGTCGAATATGCCCACATCCTT
 
. : . : . : . : . : . :
rJMSF002C15+ ATTGTATTTATGTTTTATGTTGCTTTCTCACACTTAACTGGATTTTCCTTATGATTGCCA
                      ____________________________________________________________
consensus ATTGTATTTATGTTTTATGTTGCTTTCTCACACTTAACTGGATTTTCCTTATGATTGCCA