Previous Contig 011186:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS050D06Sequence605011186 (2)pir|E84658|E846583e-64hypothetical protein At2g26280 [imported] - Arabidopsis thaliana>gb:AC004484_153
JMSF002B18Sequence235018256783011186 (2)pir|E84658|E846583e-44hypothetical protein At2g26280 [imported] - Arabidopsis thaliana>gb:AC004484_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS050D06- GAAGATGGCACA
                      ____________________________________________________________
consensus GAAGATGGCACA
 
. : . : . : . : . : . :
JMFS050D06- TCAAGATTCTAGCATCTGGAAGTATGACAGAAATGGATTAGCTGATGCAAGTGTTGGATC
                      ____________________________________________________________
consensus TCAAGATTCTAGCATCTGGAAGTATGACAGAAATGGATTAGCTGATGCAAGTGTTGGATC
 
. : . : . : . : . : . :
JMFS050D06- AAGTAGAAATTCTAATGCCATGTTTAGTTCTTTCAATGGTAGCCAAAGTAGAGGGTTCTA
                      ____________________________________________________________
consensus AAGTAGAAATTCTAATGCCATGTTTAGTTCTTTCAATGGTAGCCAAAGTAGAGGGTTCTA
 
. : . : . : . : . : . :
JMFS050D06- TGGTGACAGGTTGCAAAGTCGAGGGTCAACTCATGCAGGTCCTGTTTGGCTTGAAACTGG
                      ____________________________________________________________
consensus TGGTGACAGGTTGCAAAGTCGAGGGTCAACTCATGCAGGTCCTGTTTGGCTTGAAACTGG
 
. : . : . : . : . : . :
JMFS050D06- AGATGCAGTTGCAAACATGTATTCTGAAATTCGGGAAGAAGCTCGTGACCACGCACATTT
rJMSF002B18+ TTT
                      ____________________________________________________________
consensus AGATGCAGTTGCAAACATGTATTCTGAAATTCGGGAAGAAGCTCGTGACCACGCACATTT
 
. : . : . : . : . : . :
JMFS050D06- ACGCAATCCATACTTCGAACAGCAGGCTCGGCAGGCAAATCTTATTGGCAACAAGGCTTT
rJMSF002B18+ ACGCNATCCATANTTCGAACAGCAGGCTCGGCAGGCAANTTTTATTGGCAACAAGGCTTT
                      ____________________________________________________________
consensus ACGCAATCCATACTTCGAACAGCAGGCTCGGCAGGCAAATTTTATTGGCAACAAGGCTTT
 
. : . : . : . : . : . :
JMFS050D06- AGCTAAGGAATGGAACACTAATGGGCAGCTACATAATATGCAGATAAATACTGCTCATGG
rJMSF002B18+ AGCTAAGGAATGGAACACTAATGGGCAGCTACATAATATGCAGATAAATACTGCTCATGG
                      ____________________________________________________________
consensus AGCTAAGGAATGGAACACTAATGGGCAGCTACATAATATGCAGATAAATACTGCTCATGG
 
. : . : . : . : . : . :
JMFS050D06- GAAGTCACAAGAATCTCTATTTCGCCTAAGGAATCAAGAGATTCAAGGCAATGGCAGAGG
rJMSF002B18+ GAAGTCACAAGAATCTCTATTTCGCCTAAGGAATCAAGAGATTCAAGGCAATGGCAGAGG
                      ____________________________________________________________
consensus GAAGTCACAAGAATCTCTATTTCGCCTAAGGAATCAAGAGATTCAAGGCAATGGCAGAGG
 
. : . : . : . : . : . :
JMFS050D06- ACAAGATAGACTCATAGATCTGCATGGATATAATGTTAACGATGCTCTTCTTGTCCTGAA
rJMSF002B18+ ACAAGATAGACTCATAGATCTGCATGGATATAATGTTAACGATGCTCTTCTTGTCCTGAA
                      ____________________________________________________________
consensus ACAAGATAGACTCATAGATCTGCATGGATATAATGTTAACGATGCTCTTCTTGTCCTGAA
 
. : . : . : . : . : . :
JMFS050D06- GCGTGAGCTGGCTGGATTGAGAAATGCAGCGAGATCAACAGATCAGCAATTGCAAGTCTT
rJMSF002B18+ GCGTGAGCTGGCTGGATTGATAAATGCAGCGAGATCAACAGATCAGCAATTGCAAGTCTT
                      ____________________________________________________________
consensus GCGTGAGCTGGCTGGATTGATAAATGCAGCGAGATCAACAGATCAGCAATTGCAAGTCTT
 
. : . : . : . : . : . :
JMFS050D06- CATTTCTGTAGGAATAGGGCAGCCTACGAAGGGTTCAAGGACTCCCGGTAGAC
rJMSF002B18+ CATTTCTGTAGGAATAGGGCAGCCTACGAAGGGTTCAAGGACTCCCGGTAGACTTCCAAT
                      ____________________________________________________________
consensus CATTTCTGTAGGAATAGGGCAGCCTACGAAGGGTTCAAGGACTCCCGGTAGACTTCCAAT
 
. : . : . : . : . : . :
rJMSF002B18+ TGCCGTACAATGCTACCTGCTAGAGGAGGGCCTTGACTACTCTGAACCCCAACCAGGGCT
                      ____________________________________________________________
consensus TGCCGTACAATGCTACCTGCTAGAGGAGGGCCTTGACTACTCTGAACCCCAACCAGGGCT
 
. : . : . : . : . : . :
rJMSF002B18+ GCTCCGAGTTGTGATGTACTGAGTCAAGGTATAGGAGTTTTTTGATGACACACAGCATAA
                      ____________________________________________________________
consensus GCTCCGAGTTGTGATGTACTGAGTCAAGGTATAGGAGTTTTTTGATGACACACAGCATAA
 
. : . : . : . : . : . :
rJMSF002B18+ CCCATGGAATCATCAAGAAAAAAGAAAAAAGTAGAAAAAAAGAAAAAGAAAAAGAAAAAG
                      ____________________________________________________________
consensus CCCATGGAATCATCAAGAAAAAAGAAAAAAGTAGAAAAAAAGAAAAAGAAAAAGAAAAAG
 
. : . : . : . : . : . :
rJMSF002B18+ AAGAATATTGTTGTACCTGTAAATTGGAGGGATCAGAGATTAGGGCAACTCAGAAAGCAC
                      ____________________________________________________________
consensus AAGAATATTGTTGTACCTGTAAATTGGAGGGATCAGAGATTAGGGCAACTCAGAAAGCAC
 
. : . : . : . : . : . :
rJMSF002B18+ AGTAGGGAACAAGGAAAAAAAATGGAAATGGAGACTGTTCTGAAATTTGTACCGGTAAGG
                      ____________________________________________________________
consensus AGTAGGGAACAAGGAAAAAAAATGGAAATGGAGACTGTTCTGAAATTTGTACCGGTAAGG
 
. : . : . : . : . : . :
rJMSF002B18+ TATACTTGGTCCTTTAGGTGGATACCTTTTTGTAGCAGTTTGGGACTTGCATGAGCCAGC
                      ____________________________________________________________
consensus TATACTTGGTCCTTTAGGTGGATACCTTTTTGTAGCAGTTTGGGACTTGCATGAGCCAGC
 
. : . : . : . : . : . :
rJMSF002B18+ CCCAAGTATTTTTGTACCTTTACCTTTTTGTCTATATTTGCTGATGTATTTTGATAGAAT
                      ____________________________________________________________
consensus CCCAAGTATTTTTGTACCTTTACCTTTTTGTCTATATTTGCTGATGTATTTTGATAGAAT