Previous Contig 011175:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001P17Sequence211011175 (2)660011175 (2)gb:AC011663_15373121e-44Arabidopsis thaliana chromosome 1 BAC F5A18 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF001P17- GGGCTGAGAGATGAGCTTCTCACTCACCACCACCACCTCCCATCTCC
                      ____________________________________________________________
consensus GGGCTGAGAGATGAGCTTCTCACTCACCACCACCACCTCCCATCTCC
 
. : . : . : . : . : . :
JMSF001P17- CCAAGCCTCTGCCTTCTCTC-TCCCCTCCCTCCAAACACAAAAAGCTTAATCTATCTATC
rJMSF001P17+ CCAAGCCTCTGCCTTCTCTCTTCCCCTCCCTCCAAACACAAAAAGCTTAATCTATCTATC
                      ____________________________________________________________
consensus CCAAGCCTCTGCCTTCTCTCTTCCCCTCCCTCCAAACACAAAAAGCTTAATCTATCTATC
 
. : . : . : . : . : . :
JMSF001P17- CCCATAAAGGCATTCAAAAACATCAATAATACTAAAGCCACCCGATGCTGGGCTAACCAA
rJMSF001P17+ CCCATAAAGGCATTCAAAAACATCAATAATACTAAAGCCACCCGATGCTGGGCTAACCAA
                      ____________________________________________________________
consensus CCCATAAAGGCATTCAAAAACATCAATAATACTAAAGCCACCCGATGCTGGGCTAACCAA
 
. : . : . : . : . : . :
JMSF001P17- AAGTCTGTATTAGCTATCCAAATAGCAGCAATCTTGGCCACTGGA
rJMSF001P17+ AAGTCTGTATTAGCTATCCAAATAGCAGCAATCTTGGCCACTGGAGGTGTAGAGCCGGCT
                      ____________________________________________________________
consensus AAGTCTGTATTAGCTATCCAAATAGCAGCAATCTTGGCCACTGGAGGTGTAGAGCCGGCT
 
. : . : . : . : . : . :
rJMSF001P17+ CTGGCGGTGACGGGAGTGAATGGACAAGAAGATTTGATATGGATATTGATTCAATCAGGG
                      ____________________________________________________________
consensus CTGGCGGTGACGGGAGTGAATGGACAAGAAGATTTGATATGGATATTGATTCAATCAGGG
 
. : . : . : . : . : . :
rJMSF001P17+ ATTTCGGCCTTCTTCTACTTCATTGTTTTCCCGCCTATCCTCATGAATTGGCTGAGGATA
                      ____________________________________________________________
consensus ATTTCGGCCTTCTTCTACTTCATTGTTTTCCCGCCTATCCTCATGAATTGGCTGAGGATA
 
. : . : . : . : . : . :
rJMSF001P17+ AGGTGGTATAGGAGGAATCTGTTGGAGATGTATGTGCAGTTCATGTGTGTCTTCATCAAT
                      ____________________________________________________________
consensus AGGTGGTATAGGAGGAATCTGTTGGAGATGTATGTGCAGTTCATGTGTGTCTTCATCAAT
 
. : . : . : . : . : . :
rJMSF001P17+ TTCCCTGGCTTGGTGCTGTGGGCACCATTTCTCAACTTCAGGAAATTGCCACAAGACCCT
                      ____________________________________________________________
consensus TTCCCTGGCTTGGTGCTGTGGGCACCATTTCTCAACTTCAGGAAATTGCCACAAGACCCT
 
. : . : . : . : . : . :
rJMSF001P17+ TCCATGAAGTACCCCTGGTCGGTGCCGGAAGACAGTTCTAAGGGCAGAAACATCTACCGG
                      ____________________________________________________________
consensus TCCATGAAGTACCCCTGGTCGGTGCCGGAAGACAGTTCTAAGGGCAGAAACATCTACCGG
 
. : . : . : . : . : . :
rJMSF001P17+ AAATATCCATGGGCAACTCCGGAGGACTATGACTAATCCACAAGCTGCCTAAATTGCTTC
                      ____________________________________________________________
consensus AAATATCCATGGGCAACTCCGGAGGACTATGACTAATCCACAAGCTGCCTAAATTGCTTC
 
. : . : . : . : . : . :
rJMSF001P17+ TTTTGTCCTCTCTTCTTTCCTCTACTCATGTCTGAGCTATCAATATACAGAATTGTTTTG
                      ____________________________________________________________
consensus TTTTGTCCTCTCTTCTTTCCTCTACTCATGTCTGAGCTATCAATATACAGAATTGTTTTG
 
. : . : . : . : . : . :
rJMSF001P17+ TGTATAAACATACTGTAAATTCTATACCCTTTCAATACGCTGCATACGAACAGACAGCAC
                      ____________________________________________________________
consensus TGTATAAACATACTGTAAATTCTATACCCTTTCAATACGCTGCATACGAACAGACAGCAC