Previous Contig 011172:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001P04Sequence325011172 (4)sp|Q9C578|RCL1_ARATH7e-23Probable RNA 3'-terminal phosphate cyclase-like protein.>gb:ATT6G21_1556322 Arab773011172 (4)gb:AK175136_18171243e-64Arabidopsis thaliana mRNA for RNA 3'-terminal phosphate cyclase-like protein, co
JMSF028A13Sequence600011172 (4)sp|Q9C578|RCL1_ARATH3e-56Probable RNA 3'-terminal phosphate cyclase-like protein.>gb:ATT6G21_1556322 Arab770011172 (4)gb:AK175136_18171242e-69Arabidopsis thaliana mRNA for RNA 3'-terminal phosphate cyclase-like protein, co

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF001P04- GGGGAAATCAAGTCTCAGGGTT
                      ____________________________________________________________
consensus GGGGAAATCAAGTCTCAGGGTT
 
. : . : . : . : . : . :
JMSF001P04- TTGGCCGCCGGTACAATGGGGAAGATATCATACATGAAGCTCAAGGGGAGCCAGAGCCTG
                      ____________________________________________________________
consensus TTGGCCGCCGGTACAATGGGGAAGATATCATACATGAAGCTCAAGGGGAGCCAGAGCCTG
 
. : . : . : . : . : . :
JMSF001P04- AGGCTAAGGCTGCTGCTCTCCACCCTCTCGTCGACTCCAATACTCATCGAGGACATACGC
                      ____________________________________________________________
consensus AGGCTAAGGCTGCTGCTCTCCACCCTCTCGTCGACTCCAATACTCATCGAGGACATACGC
 
. : . : . : . : . : . :
JMSF001P04- GCCGACGCCACATGGCCCGGCCTACGCCCCCACGAAGTCTCCTTCCTCCGCCTCCTCGAG
                      ____________________________________________________________
consensus GCCGACGCCACATGGCCCGGCCTACGCCCCCACGAAGTCTCCTTCCTCCGCCTCCTCGAG
 
. : . : . : . : . : . :
JMSF001P04- AAACTCTTCGACGACTGCGTCGTTGAAATAAACGAAACTGGCACGAAGTTGAAGTACAGG
JMSF028A13- AAACTCTTCGACGACTGCGTCGTTGAAATAAACGAAACTGGCACGAAGTTGAAGTACAGG
                      ____________________________________________________________
consensus AAACTCTTCGACGACTGCGTCGTTGAAATAAACGAAACTGGCACGAAGTTGAAGTACAGG
 
. : . : . : . : . : . :
JMSF001P04- CCGGGAATAGTGATGGGTGGGAAACATTTAGCTCATGATTGTGGCGTCAATCGCGCTATT
JMSF028A13- CCGGGAATAGTGATGGGTGGGAAACATTTAGCTCATGATTGTGGCGTCAATCGCGCTATT
                      ____________________________________________________________
consensus CCGGGAATAGTGATGGGTGGGAAACATTTAGCTCATGATTGTGGCGTCAATCGCGCTATT
 
. : . : . : . : . : . :
JMSF001P04- GGG
JMSF028A13- GGGTATTTCATTGAGCCTCTCATCGTGCTTGGCTTGTTCGGGAAGAAGCCTCTTAGTATT
                      ____________________________________________________________
consensus GGGTATTTCATTGAGCCTCTCATCGTGCTTGGCTTGTTCGGGAAGAAGCCTCTTAGTATT
 
. : . : . : . : . : . :
JMSF028A13- AGGCTGAAAGGGATTACTAATGACCCAAAAGACCCGTCTATTGATACCTTTAGATCAACC
                      ____________________________________________________________
consensus AGGCTGAAAGGGATTACTAATGACCCAAAAGACCCGTCTATTGATACCTTTAGATCAACC
 
. : . : . : . : . : . :
JMSF028A13- ACCTTGCCTATTTTGAAGCTGTTTGGAGTTCCCTCAGAAGGACTGGATTTGAAAATTGAG
                      ____________________________________________________________
consensus ACCTTGCCTATTTTGAAGCTGTTTGGAGTTCCCTCAGAAGGACTGGATTTGAAAATTGAG
 
. : . : . : . : . : . :
JMSF028A13- AACAGGGGAGTTGCTCCCAATGGCGGTGGAGAAGTAATTTTGTCAGTCCCCATTGTCCAG
rJMSF028A13+ TGTCCAG
                      ____________________________________________________________
consensus AACAGGGGAGTTGCTCCCAATGGCGGTGGAGAAGTAATTTTGTCAGTCCCCATTGTCCAG
 
. : . : . : . : . : . :
JMSF028A13- GATAGTTTAAGAGCAGTTAGCTGGACTGACGTGGGATTGGTGAAGAGGATTANAGGTGTT
rJMSF028A13+ GATAGTTTAAGAGCAGTTAGCTGGACTGACGT-GGATTGGTGAAGAGGATTAGAGGTGTT
                      ____________________________________________________________
consensus GATAGTTTAAGAGCAGTTAGCTGGACTGACGTGGGATTGGTGAAGAGGATTAGAGGTGTT
 
. : . : . : . : . : . :
JMSF028A13- TCCTTTTCTACCANANTGTCTGCNCANNTTGANAATACCATGATACNTGCNNCTCNNGNC
rJMSF028A13+ TCCTTTTCTACCAGAGTGTCTGCGCAGTTTGAGAATACCATGATACATGCAGCTCGTGGC
rJMSF001P04+ CTACCAGAGTGTNTGCGCAGTTTGAGAATACCATGATACATGCAGCTCGTGGC
                      ____________________________________________________________
consensus TCCTTTTCTACCAGAGTGTCTGCGCAGTTTGAGAATACCATGATACATGCAGCTCGTGGC
 
. : . : . : . : . : . :
JMSF028A13- ATCTTGAATCCNCTACTTGCTGATGTCC
rJMSF028A13+ ATCTTGAATCCACTACTTGCTGATGTCCATATATTTACCGACCATAAAGCTGGTGTACAA
rJMSF001P04+ ATCTTGAATCCACTACTTGCTGATGTCCATATATTTACCGACCATAAAGCTGGTGTACAA
                      ____________________________________________________________
consensus ATCTTGAATCCACTACTTGCTGATGTCCATATATTTACCGACCATAAAGCTGGTGTACAA
 
. : . : . : . : . : . :
rJMSF028A13+ GCAGGAAAGTCTCCTGGCTATGGGATTTCTCTTGTTGCAGAAACTACTACTGGCTGCTTC
rJMSF001P04+ GCAGGAAAGTCTCCCGGCTATGGGATTTCTCTTGTTGCAGAAACTACTACTGGCTGCTTC
                      ____________________________________________________________
consensus GCAGGAAAGTCTCCTGGCTATGGGATTTCTCTTGTTGCAGAAACTACTACTGGCTGCTTC
 
. : . : . : . : . : . :
rJMSF028A13+ ATCTCAGCTGACACTGCTGTTTCTTATGCAAGACAAGAAGAAGATGCTGAGATTGGGGAT
rJMSF001P04+ ATCTCAGCTGACACTGCTGTTTCTTATGCAAGACAAGAAGAAGATGCTGAGATTGGGGAT
                      ____________________________________________________________
consensus ATCTCAGCTGACACTGCTGTTTCTTATGCAAGACAAGAAGAAGATGCTGAGATTGGGGAT
 
. : . : . : . : . : . :
rJMSF028A13+ GAAGATAGCATCGAGTTAACCCCTCCTGTAGATGTTGGTGAGCAAATTGCTTCCGCACTT
rJMSF001P04+ GAAGATAGCATCGAGTTAACCCCTCCTGTAGATGTTGGTGAGCAAATTGCTTCCGCACTT
                      ____________________________________________________________
consensus GAAGATAGCATCGAGTTAACCCCTCCTGTAGATGTTGGTGAGCAAATTGCTTCCGCACTT
 
. : . : . : . : . : . :
rJMSF028A13+ CTCGCGGAGATTGAACAGGGAGGTGTCGTAGATTCAACACACCAGGGTCTATTGTTTCTT
rJMSF001P04+ CTCGCGGAGATTGAACAGGGAGGTGTCGTAGATTCAACACACCAGGGTCTATTGTTTCTT
                      ____________________________________________________________
consensus CTCGCGGAGATTGAACAGGGAGGTGTCGTAGATTCAACACACCAGGGTCTATTGTTTCTT
 
. : . : . : . : . : . :
rJMSF028A13+ CTGTGTGCCTTGTGTCCACAAGATGTCTCTAAAGTTGAGGTCGGTAAGCTCTCACCCTAT
rJMSF001P04+ CTGTGTGCCTTGTGTCCACAAGATGTCTCTAAAGTTGAGGTCGGTAAGCTCTCACCCTAT
                      ____________________________________________________________
consensus CTGTGTGCCTTGTGTCCACAAGATGTCTCTAAAGTTGAGGTCGGTAAGCTCTCACCCTAT
 
. : . : . : . : . : . :
rJMSF028A13+ GCAATAGAGACTTTAAGGCACATCAGAGATTTCTTGGGAGTTAAATTCGTCATCAACCCA
rJMSF001P04+ GCAATAGAGACTTTAAGGCACATCAGAGATTTCTTGGGAGTTAAATTCGTCATCAACCCA
                      ____________________________________________________________
consensus GCAATAGAGACTTTAAGGCACATCAGAGATTTCTTGGGAGTTAAATTCGTCATCAACCCA
 
. : . : . : . : . : . :
rJMSF028A13+ GAACCCTCGTCGGGGACTGTCATACTTAAGTGCGTTGGATCTGGATTGAAGAACATGTCG
rJMSF001P04+ GAACCCTCGTCGGGGACTGTCATACTTAAGTGCGTTGGATCTGGATTGAAGAACATGTCG
                      ____________________________________________________________
consensus GAACCCTCGTCGGGGACTGTCATACTTAAGTGCGTTGGATCTGGATTGAAGAACATGTCG
 
. : . : . : . : . : . :
rJMSF028A13+ AGGAAGTTATCATGATGACCAACGGGGCGGAATGTATACTACTGAAGAAGGCCATGGCAA
rJMSF001P04+ AGGAAGTTATCATGATGACCAACGGGGCGGAATGTATACTACTGAAGAAGGCCATGGCAA
                      ____________________________________________________________
consensus AGGAAGTTATCATGATGACCAACGGGGCGGAATGTATACTACTGAAGAAGGCCATGGCAA
 
. : . : . : . : . : . :
rJMSF028A13+ GAACATGGTTGTGTAATTTGTTACAAATTTTGTAGTATCTAGCTAGAGACCCCTTACCTT
rJMSF001P04+ GAACATGGTTGTGTAATTTGTTACAAATTTTGTAGTATCTAGCTAGAGACCCCTTACCTT
                      ____________________________________________________________
consensus GAACATGGTTGTGTAATTTGTTACAAATTTTGTAGTATCTAGCTAGAGACCCCTTACCTT
 
. : . : . : . : . : . :
rJMSF028A13+ CCTTATAAGGGGTGGTGAGATCTTAGTTTTAAAGTTGTGCGCTT
rJMSF001P04+ CCTTATAAGGGGTGGTGAGATCTTAGTTTTAAAGTTGTGCGCTTATAATTTCTTCAAATT
                      ____________________________________________________________
consensus CCTTATAAGGGGTGGTGAGATCTTAGTTTTAAAGTTGTGCGCTTATAATTTCTTCAAATT
 
. : . : . : . : . : . :
rJMSF001P04+ ATTATTTGCCCTCGTGTTTGAGTTGAATGTCGCAAAATCATCGTGGGTTTTTTTGTTCGT
                      ____________________________________________________________
consensus ATTATTTGCCCTCGTGTTTGAGTTGAATGTCGCAAAATCATCGTGGGTTTTTTTGTTCGT