Previous Contig 011163:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001L09Sequence460004346 (2)gb:AY630761_16186531e-14Arabidopsis thaliana hypothetical protein (At1G26090) mRNA, complete cds.749011163 (2)gb:AC079829_17328242e-27Arabidopsis thaliana chromosome 1 BAC F28B23 genomic sequence, complete sequence
JMSF003H11Sequence232004346 (2)747011163 (2)gb:AC079829_17328242e-27Arabidopsis thaliana chromosome 1 BAC F28B23 genomic sequence, complete sequence

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF003H11+ TTACACTTTCATTCCACATCTCTCGAT
rJMSF001L09+ CCTTACACTTTCATTCCACATCTCTCGAT
                      ____________________________________________________________
consensus CCTTACACTTTCATTCCACATCTCTCGAT
 
. : . : . : . : . : . :
rJMSF003H11+ AGATACCCGCCTAGAATGGAATCATATAATGCAGGATGCTTGTAGTGAGGATGCCCGCAA
rJMSF001L09+ AGATACCCGCCTAGAATGGAATCATATAATGCAGGATGCTTGTAGTGAGGATGCCCGCAA
                      ____________________________________________________________
consensus AGATACCCGCCTAGAATGGAATCATATAATGCAGGATGCTTGTAGTGAGGATGCCCGCAA
 
. : . : . : . : . : . :
rJMSF003H11+ ACTTCTTGCTGTAACAAGCCATGGGACGAGGATCCATCCTGTTAAGTTTGATCCGGCCAA
rJMSF001L09+ ACTTCTTGCTGTAACAAGCCATGGGACGAGGATCCATCCTGTTAAGTTTGATCCGGCCAA
                      ____________________________________________________________
consensus ACTTCTTGCTGTAACAAGCCATGGGACGAGGATCCATCCTGTTAAGTTTGATCCGGCCAA
 
. : . : . : . : . : . :
rJMSF003H11+ TAAAACTGTCACGCTTCTCATGCCTGGTTTTGACAAATCGGAAATCAAACTATACCAATT
rJMSF001L09+ TAAAACTGTCACGCTTCTCATGCCTGGTTTTGACAAATCGGAAATCAAACTATACCAATT
                      ____________________________________________________________
consensus TAAAACTGTCACGCTTCTCATGCCTGGTTTTGACAAATCGGAAATCAAACTATACCAATT
 
. : . : . : . : . : . :
rJMSF003H11+ TAGAGGGGGATCTGAGTTGTTGGTCGAGGCAGGTGATCAAAGACGCGCCATTTTTCTGCC
rJMSF001L09+ TAGAGGGGGATCTGAGTTGTTGGTCGAGGCAGGTGATCAAAGACGCGCCATTTTTCTGCC
                      ____________________________________________________________
consensus TAGAGGGGGATCTGAGTTGTTGGTCGAGGCAGGTGATCAAAGACGCGCCATTTTTCTGCC
 
. : . : . : . : . : . :
rJMSF003H11+ CTCGAAGCTTCAAGGCAAGGTTGTAGCTGCCAAGTTTATCGAAAGAAGTCTTGTTATAAC
rJMSF001L09+ CTCGAAGCTTCAAGGCAAGGTTGTAGCTGCCAAGTTTATCGAAAGAAGTCTTGTTATAAC
                      ____________________________________________________________
consensus CTCGAAGCTTCAAGGCAAGGTTGTAGCTGCCAAGTTTATCGAAAGAAGTCTTGTTATAAC
 
. : . : . : . : . : . :
rJMSF003H11+ CATGCAATAACAAAAAGCTTCAAGCTTTAAGAATGGCAACAGGTCAAAGGTAACAAGCTA
rJMSF001L09+ CATGCAATAACAAAAAGCTTCAAGCTTTAAGAATGGCAACAGGTCAAAGGTAACAAGCTA
                      ____________________________________________________________
consensus CATGCAATAACAAAAAGCTTCAAGCTTTAAGAATGGCAACAGGTCAAAGGTAACAAGCTA
 
. : . : . : . : . : . :
rJMSF003H11+ CAGGAGCCACCAATTTCTAGTTGACAGTCTTTGTCCAAGAAGATGGAACTCTTTACTGGA
rJMSF001L09+ CAGGAGCCACCAATTTCTAGTTGACAGTCTTTGTCCAAGAAGATGGAACTCTTTACTGGA
                      ____________________________________________________________
consensus CAGGAGCCACCAATTTCTAGTTGACAGTCTTTGTCCAAGAAGATGGAACTCTTTACTGGA
 
. : . : . : . : . : . :
rJMSF003H11+ TTAGCTTGTGTCCAGAAGAATGAAGAATTAGAGAGACTGAAAAAGAAGTGAAAACAACCA
rJMSF001L09+ TTAGCTTGTGTCCAGAAGAATGAAGAATTAGAGAGACTGAAAAAGAAGTGAAAACAACCA
                      ____________________________________________________________
consensus TTAGCTTGTGTCCAGAAGAATGAAGAATTAGAGAGACTGAAAAAGAAGTGAAAACAACCA
 
. : . : . : . : . : . :
rJMSF003H11+ GAAGAGCGGTAAATTTGAGCATTAAATAGGCGGCACCCATGTTTCTTGTCCTGTGTCTGT
rJMSF001L09+ GAAGAGCGGTAAATTTGAGCATTAAATAGGCGGCACCCATGTTTCTTGTCCTGTGTCTGT
                      ____________________________________________________________
consensus GAAGAGCGGTAAATTTGAGCATTAAATAGGCGGCACCCATGTTTCTTGTCCTGTGTCTGT
 
. : . : . : . : . : . :
rJMSF003H11+ AACTTCTTGCCATAGGTATATCTAGTTCTGACACTTACATAGTAATGGATTGGGAAACTT
rJMSF001L09+ AACTTCTTGCCATAGGTATATCTAGTTCTGACACTTACATAGTAATGGATTGGGAAACTT
                      ____________________________________________________________
consensus AACTTCTTGCCATAGGTATATCTAGTTCTGACACTTACATAGTAATGGATTGGGAAACTT
 
. : . : . : . : . : . :
rJMSF003H11+ GAATTGTGGGATTATTATGAAACGAGAAATGATCAGATTTCTGGCTGGTTTAGGTGACTA
rJMSF001L09+ GAATTGTGGGATTATTATGAAACGAGAAATGATCAGATTTCTGGCTGGTTTAGGTGACTA
                      ____________________________________________________________
consensus GAATTGTGGGATTATTATGAAACGAGAAATGATCAGATTTCTGGCTGGTTTAGGTGACTA
 
. : . : . : . : . : . :
rJMSF003H11+ TGAAACACACAGAAAAGCATATTTTAGGAAATTTGACTAATTTGATATTAAAAGTAGTCT
rJMSF001L09+ TGAAACACACAGAAAAGCATATTTTAGGAAATTTGACTAATTTGATATTAAAAGTAGTCT
                      ____________________________________________________________
consensus TGAAACACACAGAAAAGCATATTTTAGGAAATTTGACTAATTTGATATTAAAAGTAGTCT