Previous Contig 011157:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026D17Sequence483011157 (2)pir|B86418|B864181e-30probable plasma membrane associated protein F15D2.10 - Arabidopsis thaliana>gb:A
JMSF001J10Sequence412006724 (43)pir|S33775|S337752e-51chlorophyll a/b-binding protein - garden pea>gb:PSLHCB31G_1702217 P.sativum Lhcb661011157 (2)pir|B86418|B864184e-44probable plasma membrane associated protein F15D2.10 - Arabidopsis thaliana>gb:A

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF026D17- GTATGTTTGTGTTCAAATTCTCTAAGCCATTTCATTTAA
rJMSF001J10+ A
                      ____________________________________________________________
consensus GTATGTTTGTGTTCAAATTCTCTAAGCCATTTCATTTAA
 
. : . : . : . : . : . :
JMFF026D17- TTTCCTGGTTCTCATACTTTAAGAAGACACAAGTCTCTTGTTTCTGAACATAGGGTTCAA
rJMSF001J10+ TTTCCTGGTTCTCATACTTTAAGAAGACACAAGTCTCTTGTTTCTGAACATAGGGTTCAA
                      ____________________________________________________________
consensus TTTCCTGGTTCTCATACTTTAAGAAGACACAAGTCTCTTGTTTCTGAACATAGGGTTCAA
 
. : . : . : . : . : . :
JMFF026D17- GAATGGCTAATGGGTCGAGCCTTAGATCGGTTGCATCACTGCTGTTGCTGCTGCATTTCT
rJMSF001J10+ GAATGGCTAATGGGTCGAGCCTTAGATCGGTTGCATCACTGCTGTTGCTGCTGCATTTCT
                      ____________________________________________________________
consensus GAATGGCTAATGGGTCGAGCCTTAGATCGGTTGCATCACTGCTGTTGCTGCTGCATTTCT
 
. : . : . : . : . : . :
JMFF026D17- GCATGTATGTTGTGGTCTTGGCCATTGGCGGCTGGGCGATGAACATAGCCATCGATCATG
rJMSF001J10+ GCATGTATGTTGTGGTCTTGGCCATTGGCGGCTGGGCGATGAACATAGCCATCGATCATG
                      ____________________________________________________________
consensus GCATGTATGTTGTGGTCTTGGCCATTGGCGGCTGGGCGATGAACATAGCCATCGATCATG
 
. : . : . : . : . : . :
JMFF026D17- GCTTCATCATCGGTCGAGAACTTGAACTCCCGGCGCATTTCTCACCTATATACTTCCCGA
rJMSF001J10+ GCTTCATCATCGGTCGAGAACTTGAACTCCCGGCGCATTTCTCACCTATATACTTCCCGA
                      ____________________________________________________________
consensus GCTTCATCATCGGTCGAGAACTTGAACTCCCGGCGCATTTCTCACCTATATACTTCCCGA
 
. : . : . : . : . : . :
JMFF026D17- TGGGAAACGCAGCCACCGGATTCTTTGTCACGTTTTCCCTGATCGCCGGTGNCGTTGGAG
rJMSF001J10+ TGGGAAACGCAGCCACCGGATTCTTTGTCACGTTTTCCCTGATCGCCGGTGTCGTTGGAG
                      ____________________________________________________________
consensus TGGGAAACGCAGCCACCGGATTCTTTGTCACGTTTTCCCTGATCGCCGGTGTCGTTGGAG
 
. : . : . : . : . : . :
JMFF026D17- TGGCGTCTGTCCTCGCCGGAATCAACCATATCCGCCATTGGACCATTCAGAGCATGCCTG
rJMSF001J10+ TGGCGTCTGTCCTCGCCGGAATCAACCATATCCGCCATTGGACCATTCAGAGCATGCCTG
                      ____________________________________________________________
consensus TGGCGTCTGTCCTCGCCGGAATCAACCATATCCGCCATTGGACCATTCAGAGCATGCCTG
 
. : . : . : . : . : . :
JMFF026D17- CTGCTGCTTCTGCTGCAGCTATTTCCTGGAGTCTTACTGCTCTTGCCATGGGGTTTGCTT
rJMSF001J10+ CTGCTGCTTCTGCTGCAGCTATTTCCTGGAGTCTTACTGCTCTTGCCATGGGGTTTGCTT
                      ____________________________________________________________
consensus CTGCTGCTTCTGCTGCAGCTATTTCCTGGAGTCTTACTGCTCTTGCCATGGGGTTTGCTT
 
. : . : . : . : . : . :
JMFF026D17- GGAAAGAGATTCAGCTAAACCTCA
rJMSF001J10+ GGAAAGAGATTCAGCTAAACCTCAGGAATGCCAACCTGAGAACAATGGAAGCATTCATGA
                      ____________________________________________________________
consensus GGAAAGAGATTCAGCTAAACCTCAGGAATGCCAACCTGAGAACAATGGAAGCATTCATGA
 
. : . : . : . : . : . :
rJMSF001J10+ TCATACTTACTGTCACTCAACTGGTATACATAGCCGCCATCCATGGCTCGAGAAATTAAT
                      ____________________________________________________________
consensus TCATACTTACTGTCACTCAACTGGTATACATAGCCGCCATCCATGGCTCGAGAAATTAAT
 
. : . : . : . : . : . :
rJMSF001J10+ CATAGATTATATAGATATATGCGTGAAGGAGTGTGCAGTGTGATTTATACTCTTTCTTTT
                      ____________________________________________________________
consensus CATAGATTATATAGATATATGCGTGAAGGAGTGTGCAGTGTGATTTATACTCTTTCTTTT
 
. : . : . : . : . : . :
rJMSF001J10+ TGTTATTATTATTATTATATTTTCCGTTTTTCATTCTTTTGTTGTTCACTGAAGTTATGT
                      ____________________________________________________________
consensus TGTTATTATTATTATTATATTTTCCGTTTTTCATTCTTTTGTTGTTCACTGAAGTTATGT