Previous Contig 011152:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN017A13Sequence612011152 (2)
JMSF001I15Sequence211006051 (10)gb:AP004465_18414612e-04Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P069714011152 (2)gb:AY088728_15737422e-04Arabidopsis thaliana clone 93362 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN017A13- TCAGAAGCCA
                      ____________________________________________________________
consensus TCAGAAGCCA
 
. : . : . : . : . : . :
JMFN017A13- GAGGAGATGGCATGTGCTGCTTCTTGTGTGATATCATGGGGTTGTACCAATTAAAAGGAG
                      ____________________________________________________________
consensus GAGGAGATGGCATGTGCTGCTTCTTGTGTGATATCATGGGGTTGTACCAATTAAAAGGAG
 
. : . : . : . : . : . :
JMFN017A13- GGAAAAAAATATTGGTGGGGGTGATGTAGTGTGTTTTGACTTTAGTGTTGGGTAGCATAA
rJMSF001I15+ AAATATTGGTGGGGGTGATGTAGTGTGTTTTGACTTTAGTGTTGGGTAGCATAA
                      ____________________________________________________________
consensus GGAAAAAAATATTGGTGGGGGTGATGTAGTGTGTTTTGACTTTAGTGTTGGGTAGCATAA
 
. : . : . : . : . : . :
JMFN017A13- TCACTTCCTAGCATCCTGCCTTGCTAATGATGCTTCGAGAGGGGATTTAGTCTTGTATTC
rJMSF001I15+ TCACTTCCTAGCATCCTGCCTTGCTAATGATGCTTCGAGAGGGGATTTAGTCTTGTATTC
                      ____________________________________________________________
consensus TCACTTCCTAGCATCCTGCCTTGCTAATGATGCTTCGAGAGGGGATTTAGTCTTGTATTC
 
. : . : . : . : . : . :
JMFN017A13- ACTTTTGAGCATTGTGCAAAGTTCCACAGAGATTGCTTTCCACATTCTTGGATCCATAAA
rJMSF001I15+ ACTTTTGAGCATTGTGCAAAGTTCCACAGAGATTGCTTTCCACATTCTTGGATCCATAAA
                      ____________________________________________________________
consensus ACTTTTGAGCATTGTGCAAAGTTCCACAGAGATTGCTTTCCACATTCTTGGATCCATAAA
 
. : . : . : . : . : . :
JMFN017A13- ATTTTCTTCCCCCAACGGAGGAGTTCAGATCATGTGTTACATTGTCACGAGGCTTCTGTG
rJMSF001I15+ ATTTTCTTCCCCCAACGGAGGAGTTCAGATCATGTGTTACATTGTCACGAGGCTTCTGTG
                      ____________________________________________________________
consensus ATTTTCTTCCCCCAACGGAGGAGTTCAGATCATGTGTTACATTGTCACGAGGCTTCTGTG
 
. : . : . : . : . : . :
JMFN017A13- CTTGGGCTCCTCTCATTCATTACATGGTTGTGCGTTCAATGCCATGCTCTGCATATCCCT
rJMSF001I15+ CTTGGGCTCCTCTCATTCATTACATGGTTGTGCGTTCAATGCCATGCTCTGCATATCCCT
                      ____________________________________________________________
consensus CTTGGGCTCCTCTCATTCATTACATGGTTGTGCGTTCAATGCCATGCTCTGCATATCCCT
 
. : . : . : . : . : . :
JMFN017A13- GTTGTAAGTTATTCCTGATGATTCCTTCCTGTGCTCCAATTGTTGTTTACTGTTTGTAGG
rJMSF001I15+ GTTGTAAGTTATTCCTGATGATTCCTTCCTGTGCTCCAATTGTTGTTTACTGTTTGTAGG
                      ____________________________________________________________
consensus GTTGTAAGTTATTCCTGATGATTCCTTCCTGTGCTCCAATTGTTGTTTACTGTTTGTAGG
 
. : . : . : . : . : . :
JMFN017A13- CTTGCTGCTCCACTGGTTCAGAGGAATGTTGCAAATGGAGGTGGCTTCAGTGTTAAGCAG
rJMSF001I15+ CTTGCTGCTCCACTGGTTCAGAGGAATGTTGCAAATGGAGGTGGCTTCAGTGTTAAGCAG
                      ____________________________________________________________
consensus CTTGCTGCTCCACTGGTTCAGAGGAATGTTGCAAATGGAGGTGGCTTCAGTGTTAAGCAG
 
. : . : . : . : . : . :
JMFN017A13- CAGCAGGAAATCAAGTTTATGTCACAACAAAAGCCTCAGACATTGGATTCACTGTNTGCA
rJMSF001I15+ CAGCAGGAAATCAAGTTTATGTCACAACAAAAGCCTCAGACATTGGATTCACTGTTTGCA
                      ____________________________________________________________
consensus CAGCAGGAAATCAAGTTTATGTCACAACAAAAGCCTCAGACATTGGATTCACTGTTTGCA
 
. : . : . : . : . : . :
JMFN017A13- AATATGAAAGGACAAAGGATGAAGACCTCTC-ACAGACAAATGGTGCAAGAAAAAATGGA
rJMSF001I15+ AATATGAAGGAACAAAGGATGAAGACCTCTCAACAGACAAATGGTGCAAGAAAAAATGGA
                      ____________________________________________________________
consensus AATATGAAGGGACAAAGGATGAAGACCTCTCAACAGACAAATGGTGCAAGAAAAAATGGA
 
. : . : . : . : . : . :
JMFN017A13- CGT
rJMSF001I15+ CGTAGCCAGCATCAGGCGCCATGGATAAGAGGCCGTTTTGGCAATTGATAGAGATACTAA
                      ____________________________________________________________
consensus CGTAGCCAGCATCAGGCGCCATGGATAAGAGGCCGTTTTGGCAATTGATAGAGATACTAA
 
. : . : . : . : . : . :
rJMSF001I15+ ACTACCGACGGGGAGTGAGAAGGGGGACAGTAGTGTCCTTTACAAGTAGTTCTGAGACTT
                      ____________________________________________________________
consensus ACTACCGACGGGGAGTGAGAAGGGGGACAGTAGTGTCCTTTACAAGTAGTTCTGAGACTT
 
. : . : . : . : . : . :
rJMSF001I15+ TGGTTGCCTTGAACAATGAATGATAATTGTGGCTTGCTGCTTTGTAGTTTCTGGTGACCC
                      ____________________________________________________________
consensus TGGTTGCCTTGAACAATGAATGATAATTGTGGCTTGCTGCTTTGTAGTTTCTGGTGACCC