Previous Contig 011148:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001H20Sequence373011148 (2)gb:AB010068_15108488e-16Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K18P6.>gb:AY070735_156777011148 (2)gb:OSJN00288_16980108e-66Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ000315_02, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF001H20- GGTCGCTGGTAGTTCTCTGCGACTGCGAGAG
                      ____________________________________________________________
consensus GGTCGCTGGTAGTTCTCTGCGACTGCGAGAG
 
. : . : . : . : . : . :
JMSF001H20- TGCGAGGTACAGAAAGAAGAGCACCGAAAAGGGGTTTACGAGTGATTCTCAGATGGGTGA
                      ____________________________________________________________
consensus TGCGAGGTACAGAAAGAAGAGCACCGAAAAGGGGTTTACGAGTGATTCTCAGATGGGTGA
 
. : . : . : . : . : . :
JMSF001H20- AGGAAAGCAAGGAATCATGGCCGTTCAGTTGCCTAGCCAGAACCCTATTGAACAGTTTCA
                      ____________________________________________________________
consensus AGGAAAGCAAGGAATCATGGCCGTTCAGTTGCCTAGCCAGAACCCTATTGAACAGTTTCA
 
. : . : . : . : . : . :
JMSF001H20- GGCCAAGTACAACGAACTCGCTAGCGGGGTCAAAGCCTGGCTATCCAAGCAGTCATTGCC
                      ____________________________________________________________
consensus GGCCAAGTACAACGAACTCGCTAGCGGGGTCAAAGCCTGGCTATCCAAGCAGTCATTGCC
 
. : . : . : . : . : . :
JMSF001H20- CGTCGAAGCCGCTTTCGTCACTGCCGCCAGCGCCGCCCAGGGCGGTGTAATCGGCGCTAT
                      ____________________________________________________________
consensus CGTCGAAGCCGCTTTCGTCACTGCCGCCAGCGCCGCCCAGGGCGGTGTAATCGGCGCTAT
 
. : . : . : . : . : . :
JMSF001H20- TCTGGGAAATCTCAGCCCTGACCTCCAGCCTACTCCTCCTCCCGGGGCCAATCTCGATCC
rJMSF001H20+ CCTCCTCCCGGGGCCAATCTCGATCC
                      ____________________________________________________________
consensus TCTGGGAAATCTCAGCCCTGACCTCCAGCCTACTCCTCCTCCCGGGGCCAATCTCGATCC
 
. : . : . : . : . : . :
JMSF001H20- CAACGCCATGGCCACCTTTAACCAAGCCCAGGCTCTTACAGG
rJMSF001H20+ CAACGCCATGGCCACCTTTAACCAAGCCCAGGCTCTTACAGGTGGTCCCTTGGTACAAGC
                      ____________________________________________________________
consensus CAACGCCATGGCCACCTTTAACCAAGCCCAGGCTCTTACAGGTGGTCCCTTGGTACAAGC
 
. : . : . : . : . : . :
rJMSF001H20+ TCGAAATTTTGCTGTCATGACTGGGGTGAATGCTGGCATTTCTTGTGTCTTGAAAAGGGT
                      ____________________________________________________________
consensus TCGAAATTTTGCTGTCATGACTGGGGTGAATGCTGGCATTTCTTGTGTCTTGAAAAGGGT
 
. : . : . : . : . : . :
rJMSF001H20+ GAGAGGCAAGGAGGATGTTCAGTCAAGTATGGCAGCTGCTTTTGGGTCTGGAGTCATGTA
                      ____________________________________________________________
consensus GAGAGGCAAGGAGGATGTTCAGTCAAGTATGGCAGCTGCTTTTGGGTCTGGAGTCATGTA
 
. : . : . : . : . : . :
rJMSF001H20+ TTCATTAGTTAGCGGCATGGGTGGCCCAGATGTAGTTCCTGCTGCTTTGACGTCTGGAGT
                      ____________________________________________________________
consensus TTCATTAGTTAGCGGCATGGGTGGCCCAGATGTAGTTCCTGCTGCTTTGACGTCTGGAGT
 
. : . : . : . : . : . :
rJMSF001H20+ TTTCTTTGCACTTGTTCAAGGTGGTCTTTTCAAGCTAGGACAGCAATTTTCACAGCCACC
                      ____________________________________________________________
consensus TTTCTTTGCACTTGTTCAAGGTGGTCTTTTCAAGCTAGGACAGCAATTTTCACAGCCACC
 
. : . : . : . : . : . :
rJMSF001H20+ AGCAGAAGACATGCAGTACGTTAAAACTAGATCACTATTGTCTGGACTTGGCCTAGAAAA
                      ____________________________________________________________
consensus AGCAGAAGACATGCAGTACGTTAAAACTAGATCACTATTGTCTGGACTTGGCCTAGAAAA
 
. : . : . : . : . : . :
rJMSF001H20+ ATACGAGAAAAATTTTAAGCGTGGCTTGTTGACAGATACCACTTTACCTTTGCTCACTGA
                      ____________________________________________________________
consensus ATACGAGAAAAATTTTAAGCGTGGCTTGTTGACAGATACCACTTTACCTTTGCTCACTGA
 
. : . : . : . : . : . :
rJMSF001H20+ TAGTGCACTTAAAGACGTGAGCATTCCTCCTGGACCAAGGCTTCTCATCCTTGATCAAGT
                      ____________________________________________________________
consensus TAGTGCACTTAAAGACGTGAGCATTCCTCCTGGACCAAGGCTTCTCATCCTTGATCAAGT
 
. : . : . : . : . : . :
rJMSF001H20+ ACATAGGAACCCTGATTTTAGACGCAAATGAAGTGGCTGCTAGCTAGGGATCCACTTATG
                      ____________________________________________________________
consensus ACATAGGAACCCTGATTTTAGACGCAAATGAAGTGGCTGCTAGCTAGGGATCCACTTATG
 
. : . : . : . : . : . :
rJMSF001H20+ GAGTTAGCAGAGTATGTTTGAATGTTGAGAAATTTGTTATACTCTAATACTCATGATTCC
                      ____________________________________________________________
consensus GAGTTAGCAGAGTATGTTTGAATGTTGAGAAATTTGTTATACTCTAATACTCATGATTCC