Previous Contig 011140:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001E05Sequence427006661 (8)gb:AF053104_17644279e-34Nicotiana tabacum peroxisomal targeting signal 1 receptor (PEX5) mRNA, complete 758011140 (5)gb:AF056282_17646937e-65Nicotiana tabacum clone 165 peroxisomal targeting sequence 1 receptor (PEX5) mRN
JMSF010B16Sequence238006661 (8)gb:AY056299_15636104e-05Arabidopsis thaliana putative peroxisomal targeting signal type 1 receptor prote757011140 (5)gb:AF056282_17646932e-65Nicotiana tabacum clone 165 peroxisomal targeting sequence 1 receptor (PEX5) mRN
JMSF030F24Sequence648006661 (8)gb:AF053104_17644271e-60Nicotiana tabacum peroxisomal targeting signal 1 receptor (PEX5) mRNA, complete 646011140 (5)gb:AF056282_17646931e-88Nicotiana tabacum clone 165 peroxisomal targeting sequence 1 receptor (PEX5) mRN
JMSF043F01Sequence678006661 (8)gb:AF053104_17644275e-66Nicotiana tabacum peroxisomal targeting signal 1 receptor (PEX5) mRNA, complete 737011140 (5)gb:AF056283_1764694e-107Nicotiana tabacum clone 354 peroxisomal targeting sequence 1 receptor (PEX5) mRN
JMSF045J15Sequence776006661 (8)gb:AF053104_17644277e-84Nicotiana tabacum peroxisomal targeting signal 1 receptor (PEX5) mRNA, complete 688011140 (5)gb:AF056282_17646933e-56Nicotiana tabacum clone 165 peroxisomal targeting sequence 1 receptor (PEX5) mRN

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF043F01+ TTGGAAGTCCTCCTTGCCCTTGGGGTGAGCCACA
                      ____________________________________________________________
consensus TTGGAAGTCCTCCTTGCCCTTGGGGTGAGCCACA
 
. : . : . : . : . : . :
rJMSF043F01+ CAAATGAACTGGAACAAGCAGCTGCATTGAAGTATTTGTACAGTTGGTTACGCCATCACC
                      ____________________________________________________________
consensus CAAATGAACTGGAACAAGCAGCTGCATTGAAGTATTTGTACAGTTGGTTACGCCATCACC
 
. : . : . : . : . : . :
rJMSF043F01+ CTAAGTATGGAAGTATTGCCCCTGCAGATCAACCTGAGTCCCTATATTATGCAGATGTTG
rJMSF030F24+ GGAAGTATTGCCCCTGCAGATCAACCTGAGTCCCTATATTATGCAGATGTTG
                      ____________________________________________________________
consensus CTAAGTATGGAAGTATTGCCCCTGCAGATCAACCTGAGTCCCTATATTATGCAGATGTTG
 
. : . : . : . : . : . :
rJMSF043F01+ CTAGATTATTTAATGATGCTGCTCAAATGGCACCTGATGACGCTGATGTACACATAGTAC
rJMSF030F24+ CTAGATTATTTAATGATGCTGCTCAAATGGCACCTGATGACGCTGATGTACACATAGTAC
                      ____________________________________________________________
consensus CTAGATTATTTAATGATGCTGCTCAAATGGCACCTGATGACGCTGATGTACACATAGTAC
 
. : . : . : . : . : . :
rJMSF043F01+ TGGGAGTATTATACAACTTATCAAGGGAGTATGATAAAGCTATTGAATCATTTAAAATTG
rJMSF030F24+ TGGGAGTATTATACAACTTATCAAGGGAGTATGATAAAGCTATTGAATCATTTAAAATTG
rJMSF010B16+ AGGGAGTATGATAAAGCTATTGAATCATTTAAAATTG
rJMSF001E05+ AGGGAGTATGATAAAGCTATTGAATCATTTAAAATTG
                      ____________________________________________________________
consensus TGGGAGTATTATACAACTTATCAAGGGAGTATGATAAAGCTATTGAATCATTTAAAATTG
 
. : . : . : . : . : . :
rJMSF043F01+ CTTTGAAACTCAAGCCACGAGACTACTCACTCTGGAATAAGCTTGGCGCTACACAGGCTA
rJMSF030F24+ CTTTGAAACTCAAGCCACGAGACTACTCACTCTGGAATAAGCTTGGCGCTACACAGGCTA
rJMSF010B16+ CTTTGAAACTCAAGCCACGAGACTACTCACTCTGGAATAAGCTTGGCGCTACACAGGCTA
rJMSF045J15+ ACTCAAGCCACGAGACTACTCACTCTGGAATAAGCTTGGCGCTACACAGGCTA
rJMSF001E05+ CNTTGGAACTCAAGCCACGAGACTACTCACTCTGGAATAAGCTTGGCGCTACACAGGCTA
                      ____________________________________________________________
consensus CTTTGAAACTCAAGCCACGAGACTACTCACTCTGGAATAAGCTTGGCGCTACACAGGCTA
 
. : . : . : . : . : . :
rJMSF043F01+ ACAGTGTTCAGAGTGCTGATGCAATATTGGCCTATCAGCAGGCACTAGATTTGAAACCGA
rJMSF030F24+ ACAGTGTTCAGAGTGCTGATGCAATATTGGCCTATCAGCAGGCACTAGATTTGAAACCGA
rJMSF010B16+ ACAGTGTTCAGAGTGCTGATGCAATATTGGCCTATCAGCAGGCACTAGATTTGAAACCGA
rJMSF045J15+ ACAGTGNTCAGAGTGCTGATGCAATATTGGCCTATCAGCAGGCNCTAGATTTGAAACCGA
rJMSF001E05+ ACAGTGTTCAGAGTGCTGATGCAATATTGGCCTATCAGCAGGCACTAGATTTGAAACCGA
                      ____________________________________________________________
consensus ACAGTGTTCAGAGTGCTGATGCAATATTGGCCTATCAGCAGGCACTAGATTTGAAACCGA
 
. : . : . : . : . : . :
rJMSF043F01+ ATTATGTGCGTGCATGGGCAAACATGGGTATCAGTTATGCCAACCAGGGTATGTACGAGG
rJMSF030F24+ ATTATGTGCGTGCATGGGCAAACATGGGTATCAGTTATGCCAACCAGGGTATGTACGAGG
rJMSF010B16+ ATTATGTGCGTGCATGGGCAAACATGGGTATCAGTTATGCCAACCAGGGTATGTACGAGG
rJMSF045J15+ ATTATGTGCGTGCATGGGCAAACATGGGTATCAGTTATGCCAACCNGGGTATGTACGAGG
rJMSF001E05+ ATTATGTGCGTGCATGGGCAAACATGGGTATCAGTTATGCCAACCAGGGTATGTACGAGG
                      ____________________________________________________________
consensus ATTATGTGCGTGCATGGGCAAACATGGGTATCAGTTATGCCAACCAGGGTATGTACGAGG
 
. : . : . : . : . : . :
rJMSF043F01+ ACTCTATTCGTTATTATGTCCGTGCATTAGGAATGAATCCAAAGGCAGATAATGCATGGC
rJMSF030F24+ ACTCTATTCGTTATTATGTCCGTGCATTAGGAATGAATCCAAAGGCAGATAATGCATGGC
rJMSF010B16+ ACTCTATTCGTTATTATGTCCGTGCATTAGGAATGAATCCAAAGGCAGATAATGCATGGC
rJMSF045J15+ ACTCTATTCGTTATTATGTCCGTGCATTAGGAATGAATCCAAAGGCAGATAATGCATGGC
rJMSF001E05+ ACTCTATTCGTTATTATGTCCGTGCATTAGGAATGAATCCAAAGGCAGATAATGCATGGC
                      ____________________________________________________________
consensus ACTCTATTCGTTATTATGTCCGTGCATTAGGAATGAATCCAAAGGCAGATAATGCATGGC
 
. : . : . : . : . : . :
rJMSF043F01+ AATATTTGAGAATTTCTTTGAGCTGTGCATCACGAAATGATATGATTGAAGCTTGCGATT
rJMSF030F24+ AATATTTGAGAATTTCTTTGAGCTGTGCATCACGAAATGATATGATTGAAGCTTGCGATT
rJMSF010B16+ AATATTTGAGAATTTCTTTGAGCTGTGCATCACGAAATGATATGATTGAAGCTTGCGATT
rJMSF045J15+ AATATTTGAGAATTTCTTTGAGCTGTGCATCNCGAAATGATATGATTGAAGCTTGCGATT
rJMSF001E05+ AATATTTGAGAATTTCTTTGAGCTGTGCATCACGAAATGATATGATTGAAGCTTGCGATT
                      ____________________________________________________________
consensus AATATTTGAGAATTTCTTTGAGCTGTGCATCACGAAATGATATGATTGAAGCTTGCGATT
 
. : . : . : . : . : . :
rJMSF043F01+ CACGGAACCTTGATGTTCTCCAAAAAGAGTTCCCCTTATAAATACAAAAAATGTGGCATG
rJMSF030F24+ CACGGAACCTTGATGTTCTCCAAAAAGAGTTCCCCTTATAAATACAAAAAATGTGGCATG
rJMSF010B16+ CACGGAACCTTGATGTTCTCCAAAAAGAGTTCCCCTTATAAATACAAAAAATGTGGCATG
rJMSF045J15+ CACGGAACCTTGATGTTCTCCAAAAAGAGTTCCCCTTATAAATACAAAAAATGTGGCATG
rJMSF001E05+ CACGGAACCTTGATGTTCTCCAAAAAGAGTTCCCCTTATAAATACAAAAAATGTGGCATG
                      ____________________________________________________________
consensus CACGGAACCTTGATGTTCTCCAAAAAGAGTTCCCCTTATAAATACAAAAAATGTGGCATG
 
. : . : . : . : . : . :
rJMSF043F01+ CTTCTAACACGTGATCAAATGAGGCATGTGCATGAAGTTGCAAGACCATCCAATTGAGCC
rJMSF030F24+ CTTCTAACACGTGATCAAATGAGGCATGTGCATGAAGTTGCAAGACCATCCAATTGAGCC
rJMSF010B16+ CTTCTAACACGTGATCAAATGAGGCATGTGCATGAAGTTGCAAGACCATCCAATTGAGCC
rJMSF045J15+ CTTCTAACACGTGATCAAATGAGGCATGTGCATGAAGTTGCAAGACCATCCAATTGAGCC
rJMSF001E05+ CTTCTAACACGTGATCAAATGAGGCATGTGCATGAAGTTGCAAGACCATCCAATTGAGCC
                      ____________________________________________________________
consensus CTTCTAACACGTGATCAAATGAGGCATGTGCATGAAGTTGCAAGACCATCCAATTGAGCC
 
. : . : . : . : . : . :
rJMSF043F01+ GATATTTTCTTTAGTTATTAATATCTTGAATCACAATTACTAT
rJMSF030F24+ GATATTTTCTTTAGTTATTAATATCTTGAATCACAATTACTATTGTTCATCACT
rJMSF010B16+ GATATTTTCTTTAGTTATTAATATCTTGAATCACAATTACTATTGTTCATCACTTATTTG
rJMSF045J15+ GATATTTTCTTTAGTTATTAATATCTTGAATCACAATTACTATTGTTCATCACTTATTTG
rJMSF001E05+ GATATTTTCTTTAGTTATTAATATCTTGAATCACAATTACTATTGTTCATCACTTATTTG
                      ____________________________________________________________
consensus GATATTTTCTTTAGTTATTAATATCTTGAATCACAATTACTATTGTTCATCACTTATTTG
 
. : . : . : . : . : . :
rJMSF010B16+ GATCCCTTAATAATACTAGTGTGGTTCACTCATTCAGAACTAGAGGATCAACTAGCAGCA
rJMSF045J15+ GATCCCTTAATAATACTAGTGTGGTTCACTCATTCAGAACTAGAGGATCAACTAGCAGCA
rJMSF001E05+ GATCCCTTAATAATACTAGTGTGGTTCACTCATTCAGAACTAGAGGATCAACTAGCAGCA
                      ____________________________________________________________
consensus GATCCCTTAATAATACTAGTGTGGTTCACTCATTCAGAACTAGAGGATCAACTAGCAGCA
 
. : . : . : . : . : . :
rJMSF010B16+ CTTTTCCGAAATTTTATAAAGCTCCAACTGCCACCGGGTAACCTAGAGGTAGGTGTAGTT
rJMSF045J15+ CTTTTCCGAAATTTTATAAAGCTCCAACTGCCCCCGGGTAACCTAGAGGTAGGTGTAGTT
rJMSF001E05+ CTTTTCCGAAATTTTATAAAGCTCCAACTGCCACCGGGTAACCTAGAGGTAGGTGTAGTT
                      ____________________________________________________________
consensus CTTTTCCGAAATTTTATAAAGCTCCAACTGCCACCGGGTAACCTAGAGGTAGGTGTAGTT
 
. : . : . : . : . : . :
rJMSF010B16+ TGAGAAACACTGCTATGAAGTTGATTGTATGTTTGGAGTGGGGGAAAATAGTCGACCTTG
rJMSF045J15+ TGAGAAACNCTGCTATGAAGTTGATTGTATGTTTGGAGTGGGGGAAAATAGTCGACCTTG
rJMSF001E05+ TGAGAAACACTGCTATGAAGTTGATTGTATGTTTGGAGTGGGGGAAAATAGTCGACCTTG
                      ____________________________________________________________
consensus TGAGAAACACTGCTATGAAGTTGATTGTATGTTTGGAGTGGGGGAAAATAGTCGACCTTG
 
. : . : . : . : . : . :
rJMSF010B16+ TTAGGGTGGTAAAGAAAAATAAGCTGTTGTAGAGTTCACCATTGTATAAATGTGAGTACC
rJMSF045J15+ TTAGGGTGGTAAAGAAAAATAAGCTGTTGTAGAGT
rJMSF001E05+ TTAGGGTGGTAAAGAAAAATAAGCTGTTGTAGAGTTCACCATTGTATAAATGTGAGTACC
                      ____________________________________________________________
consensus TTAGGGTGGTAAAGAAAAATAAGCTGTTGTAGAGTTCACCATTGTATAAATGTGAGTACC