Previous Contig 011133:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS022E06Sequence598011133 (4)
JMSF001B22Sequence297005751 (4)728011133 (4)gb:AB012240_15116840.025Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K18C1.
JMSF037D08Sequence678005751 (4)gb:AK117509_18155418e-29Arabidopsis thaliana At4g19600 mRNA for unknown protein, complete cds, clone: RA794011133 (4)gb:AB012240_15116840.013Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K18C1.
JMSF038K05Sequence703005751 (4)gb:AK117509_18155417e-33Arabidopsis thaliana At4g19600 mRNA for unknown protein, complete cds, clone: RA928011133 (4)gb:AB012240_15116840.001Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K18C1.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF038K05+ TTTGGTGATGGTGAGACTAGTG
                      ____________________________________________________________
consensus TTTGGTGATGGTGAGACTAGTG
 
. : . : . : . : . : . :
rJMSF038K05+ ATAAGCATAATCATGAAAGAGAGCCATTGCATTACCAGATCGGTGGGGAAGTACAAAACC
                      ____________________________________________________________
consensus ATAAGCATAATCATGAAAGAGAGCCATTGCATTACCAGATCGGTGGGGAAGTACAAAACC
 
. : . : . : . : . : . :
JMFS022E06- CATGGTGAAGAAGACCGAGAACGAAATGCTGGGAGAA
rJMSF038K05+ GATCAAAGTCTAGTCTTGACAGCCATGGTGAAGAAGACCTGGAAGGGAATGCTGGGAGAA
                      ____________________________________________________________
consensus GATCAAAGTCTAGTCTTGACAGCCATGGTGAAGAAGACCTGGAAGGGAATGCTGGGAGAA
 
. : . : . : . : . : . :
JMFS022E06- CTGAAACAAGGGATAAGGGGGAATTGAAGGACAAGTACTATGGTCGAGCTTTGGAGCGCA
rJMSF038K05+ GTGAAACAAGAGATAAGGCAGAACTGAAGGACAAGTTCCATGGTCGGGCCTTGGAGCACA
                      ____________________________________________________________
consensus GTGAAACAAGGGATAAGGGGGAATTGAAGGACAAGTTCTATGGTCGGGCTTTGGAGCGCA
 
. : . : . : . : . : . :
JMFS022E06- AGGATGGTGCAGTTGGTCAATCACCGCAGGAGGTGATTAAAAAGATTGACAAAGACAAGG
rJMSF038K05+ AGGATGGCATGGTTGGCCAATCACCACAAGAGGTTATCAAGAAGATTGACAAAGACAAGG
                      ____________________________________________________________
consensus AGGATGGTGTGGTTGGTCAATCACCGCAGGAGGTTATTAAGAAGATTGACAAAGACAAGG
 
. : . : . : . : . : . :
JMFS022E06- TCAAAGCAGCACTTGAGAGGAACAGGAAGTCCCGTGGGGATTCAACTAGGAAAGTTGATT
rJMSF038K05+ TCAAAGCAGCACTTGAGAGAAACAGAAAGTCCCGCGGGGATGCACCTAGGAAAGTAGATG
                      ____________________________________________________________
consensus TCAAAGCAGCACTTGAGAGGAACAGGAAGTCCCGTGGGGATTCACCTAGGAAAGTTGATT
 
. : . : . : . : . : . :
JMFS022E06- ACATGGATGAGGATGATCTCATTGAAAGAGAATTGGAGGATGGAATAGAGTTAGCTGCCG
rJMSF038K05+ TATTGGATGATGACGATCTCATTGAAAGAGAATTGGAGGATGGAATAGAGTTAGCTGCTG
                      ____________________________________________________________
consensus TCTTGGATGATGATGATCTCATTGAAAGAGAATTGGAGGATGGAATAGAGTTAGCTGCTG
 
. : . : . : . : . : . :
JMFS022E06- AGAATGAAAAAAACAAACGTGAAAGAAAACAAAGCTGGTCTAAATCTTCAATCAAGTCAG
rJMSF038K05+ AGGCTGAAAAGAACAAGCGGGAAAAAAAACAAAGTTGGTCTAAACCTTCAAACAGGCCAG
                      ____________________________________________________________
consensus AGGCTGAAAAGAACAAGCGTGAAAGAAAACAAAGTTGGTCTAAATCTTCAATCAGGTCAG
 
. : . : . : . : . : . :
JMFS022E06- AGCATGA
rJMSF038K05+ AGCATGACAATGCACATCACATGAAGCATCAAGATGACTCTGGTGATAGACATTACCAAG
rJMSF037D08+ TACCCAG
                      ____________________________________________________________
consensus AGCATGACAATGCACATCACATGAAGCATCAAGATGACTCTGGTGATAGACATTACCCAG
 
. : . : . : . : . : . :
rJMSF038K05+ GAATGAAAGGGCAGTCCTTGCAAAATGATGATTATGAGAATAACGTGGAAGAGGGAGAAT
rJMSF037D08+ GAATGAAAGGGCAGTCC-TGCAAAATGATGATTATGAGAATAACGTGGAAGAGGGAGAAT
rJMSF001B22+ GGGAGAAT
                      ____________________________________________________________
consensus GAATGAAAGGGCAGTCCTTGCAAAATGATGATTATGAGAATAACGTGGAAGAGGGAGAAT
 
. : . : . : . : . : . :
rJMSF038K05+ TCGAACCTTACGATGATGCTGACAGGGGTGGTTACCATTCACCTAAGTCAATCAACCGTA
rJMSF037D08+ TCGNACCTTACGATGATGCTGACAGGGGTGGTTACCATTCACCTAAGTCAATCAACCGTA
rJMSF001B22+ TCGAACCTTACGATGATGCTGACAGGGGTGGTTACCATTCACCTAAGTCAATCAACCGTA
                      ____________________________________________________________
consensus TCGAACCTTACGATGATGCTGACAGGGGTGGTTACCATTCACCTAAGTCAATCAACCGTA
 
. : . : . : . : . : . :
rJMSF038K05+ AGCGAAAGGCAAGTAGCCCTCCTGTGGATGGTAAGCATCGACACGAGTATATGTCAGCAA
rJMSF037D08+ AGCGAAAGGCAAGTAGCCCTCCTGTGGATGGTAAGCATCGACACGAGTATATGTCAGCAA
rJMSF001B22+ AGCGAAAGGCAAGTAGCCCTCCTGTGGATGGTAAGCATCGACACGAGTATATGTCAGCAA
                      ____________________________________________________________
consensus AGCGAAAGGCAAGTAGCCCTCCTGTGGATGGTAAGCATCGACACGAGTATATGTCAGCAA
 
. : . : . : . : . : . :
rJMSF038K05+ GCCACAATCACACATACCATGACTTCCCAGAGGATAGAAATAGGACAGGGAGACTTGGTT
rJMSF037D08+ GCCACAATCACACATACCATGACTTCCCAGAGGATAGAAATAGGACAGGGAGACTTGGTT
rJMSF001B22+ GCCACAATCACACATACCATGACTTCCCAGAGGATAGAAATAGGACAGGGAGACTTGGTT
                      ____________________________________________________________
consensus GCCACAATCACACATACCATGACTTCCCAGAGGATAGAAATAGGACAGGGAGACTTGGTT
 
. : . : . : . : . : . :
rJMSF038K05+ ATTCAGAAAGGGACCACAAAAGGCACGCACAGGAGAATCACGTGTAGAATGCTTTAGAGT
rJMSF037D08+ ATTCAGAAAGGGACCACAAAAGGCACGCACAGGAGAATCACGTGTAGAATGCTTTAGAGT
rJMSF001B22+ ATTCAGAAAGGGACCACAAAAGGCACGCACAGGAGAATCACGTGTAGAATGCTTTAGAGT
                      ____________________________________________________________
consensus ATTCAGAAAGGGACCACAAAAGGCACGCACAGGAGAATCACGTGTAGAATGCTTTAGAGT
 
. : . : . : . : . : . :
rJMSF038K05+ GTAATAGCAGCACCATGTCTTAGTTATGAACATTATACAAGGTCGGTGAAGCAGAGTTTT
rJMSF037D08+ GTAATAGCAGCACCATGTCTTAGTTATGAACATTATACAAGGTCGGTGAAGCAGAGTTTT
rJMSF001B22+ GTAATAGCAGCACCATGTCTTAGTTATGAACATTATACAAGGTCGGTGAAGCAGAGTTTT
                      ____________________________________________________________
consensus GTAATAGCAGCACCATGTCTTAGTTATGAACATTATACAAGGTCGGTGAAGCAGAGTTTT
 
. : . : . : . : . : . :
rJMSF038K05+ CAAGGTTAGTACAGTTGTGATCTCCGCCTGTGGTTTGGTTTATCTTGCTAAACAATTTTG
rJMSF037D08+ CAAGGTTAGTACAGTTGTGATCTCCGCCTGTGGTTTGGTTTATCTTGCTAAACAATTTTG
rJMSF001B22+ CAAGGTTAGTACAGTTGTGATCTCCGCCTGTGGTTTGGTTTATCTTGCTAAACAATTTTG
                      ____________________________________________________________
consensus CAAGGTTAGTACAGTTGTGATCTCCGCCTGTGGTTTGGTTTATCTTGCTAAACAATTTTG
 
. : . : . : . : . : . :
rJMSF038K05+ GACAGC
rJMSF037D08+ GACAGCATAAATCTTGAATTGGTCATGGTTCTGAAATTCCTACAGATTTGGGTGGTGAAA
rJMSF001B22+ GACAGCATAAATCTTGAATTGGTCATGGTTCTGAAATTCCTACAGATTTGGGTGGTGAAA
                      ____________________________________________________________
consensus GACAGCATAAATCTTGAATTGGTCATGGTTCTGAAATTCCTACAGATTTGGGTGGTGAAA
 
. : . : . : . : . : . :
rJMSF037D08+ CACAGCTTTATTGGGTAGGACTGTAGGATTGTGATGGAAGTCCATGCTTTGAGGTGCTAA
rJMSF001B22+ CACAGCTTTATTGGGTAGGACTGTAGGATTGTGATGGAAGTCCATGCTTTGAGGTGCTAA
                      ____________________________________________________________
consensus CACAGCTTTATTGGGTAGGACTGTAGGATTGTGATGGAAGTCCATGCTTTGAGGTGCTAA
 
. : . : . : . : . : . :
rJMSF037D08+ ATTTTTTTTGGGTCAGCTTAAATCTTCAATTGATTAGATAATATCTATTTATAGAATCAA
rJMSF001B22+ ATTTTTTTTGGGTCAGCTTAAATCTTCAATTGATTAGATAATATCTATTTATAGAATCAA
                      ____________________________________________________________
consensus ATTTTTTTTGGGTCAGCTTAAATCTTCAATTGATTAGATAATATCTATTTATAGAATCAA
 
. : . : . : . : . : . :
rJMSF037D08+ AATTCAAAATGTGTAACATTATTTTTCCTTAGGGCGTGGGGACGGACTATACACGCTCCC
rJMSF001B22+ AATTCAAAATGTGTAACATTATTTTTCCTTAGGGCGTGGGGACGGACTATACACGCTCCC
                      ____________________________________________________________
consensus AATTCAAAATGTGTAACATTATTTTTCCTTAGGGCGTGGGGACGGACTATACACGCTCCC
 
. : . : . : . : . : . :
rJMSF037D08+ CGTCTCCCCTCCCACACATTTTCCTGCTTCCCATCATACATGTTAAGAGTCCCAGGATCG
rJMSF001B22+ CGTCTCCCCTCCCACACATTTTCCTGCTTCCCATCATACATGTTAAGAGTCCCAGGATCG
                      ____________________________________________________________
consensus CGTCTCCCCTCCCACACATTTTCCTGCTTCCCATCATACATGTTAAGAGTCCCAGGATCG
 
. : . : . : . : . : . :
rJMSF037D08+ GTTGTATTTTATGGTAGTTGTATAAGTTATCCCCATGGGCTTAAATAACCATTGGGCACA
rJMSF001B22+ GTTGTATTTTATGGTAGTTGTATAAGTTATCCCCATGGGCTTAAATAACCATTGGGCACA
                      ____________________________________________________________
consensus GTTGTATTTTATGGTAGTTGTATAAGTTATCCCCATGGGCTTAAATAACCATTGGGCACA