Previous Contig 011129:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007L18Sequence477004278 (2)pir|B86427|B864275e-15hypothetical protein F12P21.7 - Arabidopsis thaliana>gb:AE005172_891874 Arabidop801011129 (2)pir|B86427|B864273e-35hypothetical protein F12P21.7 - Arabidopsis thaliana>gb:AE005172_891874 Arabidop
JMSF001A08Sequence225004278 (2)729011129 (2)pir|B86427|B864271e-24hypothetical protein F12P21.7 - Arabidopsis thaliana>gb:AE005172_891874 Arabidop

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF007L18+ CTGAGAATAATCCCCAAATGACTCCTCAGCAGGAGAAAGAGCATTCAGACATGCCG
                      ____________________________________________________________
consensus CTGAGAATAATCCCCAAATGACTCCTCAGCAGGAGAAAGAGCATTCAGACATGCCG
 
. : . : . : . : . : . :
rJMFF007L18+ AGCATGCATCAGTCTTCAGATGAACAGATTGACGGGACTGAGTTTACACAAGCAACCATA
                      ____________________________________________________________
consensus AGCATGCATCAGTCTTCAGATGAACAGATTGACGGGACTGAGTTTACACAAGCAACCATA
 
. : . : . : . : . : . :
rJMFF007L18+ CCGGATGAGGAAGCAGATAAATGTGCCGAGGGAGAAGGAAGACAGAATTTTGACACTGAT
                      ____________________________________________________________
consensus CCGGATGAGGAAGCAGATAAATGTGCCGAGGGAGAAGGAAGACAGAATTTTGACACTGAT
 
. : . : . : . : . : . :
rJMFF007L18+ ATGGAAATGGAGTTACTTGATGAAAAAATAAGGATATGGTTAACTGGTAAGGAAGGTGAC
rJMSF001A08+ GAAGGTGAC
                      ____________________________________________________________
consensus ATGGAAATGGAGTTACTTGATGAAAAAATAAGGATATGGTTAACTGGTAAGGAAGGTGAC
 
. : . : . : . : . : . :
rJMFF007L18+ ATCCGGTTGCTCCTGTCAACGCTGCACCACATTCTATGGTTTAACAGCGGATGGCTCCCA
rJMSF001A08+ ATCCGGTTGCTCCTGTCAACGCTGCACCACATTCTATGGTTTAACAGCGGATGGCTCCCA
                      ____________________________________________________________
consensus ATCCGGTTGCTCCTGTCAACGCTGCACCACATTCTATGGTTTAACAGCGGATGGCTCCCA
 
. : . : . : . : . : . :
rJMFF007L18+ GTCCCTTTAACTTACCTAATCGAAAGCTCGAGAGTGAAGAAGGCTTATCAGAAAGCTAGG
rJMSF001A08+ GTCCCTTTAACTTACCTAATCGAAAGCTCGAGAGTGAAGAAGGCTTATCAGAAAGCTAGG
                      ____________________________________________________________
consensus GTCCCTTTAACTTACCTAATCGAAAGCTCGAGAGTGAAGAAGGCTTATCAGAAAGCTAGG
 
. : . : . : . : . : . :
rJMFF007L18+ CTTTGTCTGCACCCAGACAAACTGCAACAAAGAGGCGCAACTATCCCTCAAAAACACATT
rJMSF001A08+ CTTTGTCTGCACCCAGACAAACTGCAACAAAGAGGCGCAACTATCCCTCAAAAACACATT
                      ____________________________________________________________
consensus CTTTGTCTGCACCCAGACAAACTGCAACAAAGAGGCGCAACTATCCCTCAAAAACACATT
 
. : . : . : . : . : . :
rJMFF007L18+ GCAGAGAAAGTGTTTTCTATCCTCCAGGATGCCTGGGCTGTGTTCCTTTCACAAGATATC
rJMSF001A08+ GCAGAGAAAGTGTTTTCTATCCTCCAGGATGCCTGGGCTGTGTTCCTTTCACAAGATATC
                      ____________________________________________________________
consensus GCAGAGAAAGTGTTTTCTATCCTCCAGGATGCCTGGGCTGTGTTCCTTTCACAAGATATC
 
. : . : . : . : . : . :
rJMFF007L18+ CGCATTGGTTGACCACGGTTCAAACCAAACCAACGCGGTGTCGGTTAAAGGCAAGTGAGG
rJMSF001A08+ CGCATTGGTTGACCACGGTTCAAACCAAACCAACGCGGTGTCGGTTAAAGGCAAGTGAGG
                      ____________________________________________________________
consensus CGCATTGGTTGACCACGGTTCAAACCAAACCAACGCGGTGTCGGTTAAAGGCAAGTGAGG
 
. : . : . : . : . : . :
rJMFF007L18+ TGAGGTGAGATGCATATGTGAATGATGACAAGGAGATGGGAATGGAACAAAATGGCAGCA
rJMSF001A08+ TGAGGTGAGATGCATATGTGAATGATGACAAGGAGATGGGAATGGAACAAAATGGCAGCA
                      ____________________________________________________________
consensus TGAGGTGAGATGCATATGTGAATGATGACAAGGAGATGGGAATGGAACAAAATGGCAGCA
 
. : . : . : . : . : . :
rJMFF007L18+ AATTGCCAAACACTAGTGACCATGAACCGTACAATGTATGTGGAATCAGGGGTTTGGTTT
rJMSF001A08+ AATTGCCAAACACTAGTGACCATGAACCGTACAATGTATGTGGAATCAGGGGTTTGGTTT
                      ____________________________________________________________
consensus AATTGCCAAACACTAGTGACCATGAACCGTACAATGTATGTGGAATCAGGGGTTTGGTTT
 
. : . : . : . : . : . :
rJMFF007L18+ CTTAAGCCTGTCTGCCAGTTGAAGAGAGAGCTGTTCTGTACAAAGCACTATGCACCACCT
rJMSF001A08+ CTTAAGCCTGTCTGCCAGTTGAAGAGAGAGCTGTTCTGTACAAAGCACTATGCACCACCT
                      ____________________________________________________________
consensus CTTAAGCCTGTCTGCCAGTTGAAGAGAGAGCTGTTCTGTACAAAGCACTATGCACCACCT
 
. : . : . : . : . : . :
rJMFF007L18+ CATCATCATCATCATCATGTTACTCTCTTCTCTTTTGGATGGATGCTTGTGTTTGTATTT
rJMSF001A08+ CATCATCATCATCATCATGTTACTCTCTTCTCTTTTGGATGGATGCTTGTGTTTGTATTT
                      ____________________________________________________________
consensus CATCATCATCATCATCATGTTACTCTCTTCTCTTTTGGATGGATGCTTGTGTTTGTATTT
 
. : . : . : . : . : . :
rJMFF007L18+ TACTTGTATTATACACTACTGCTT
rJMSF001A08+ TACTTGTATTATACACTACTGCTTTAATAGATCACGTTTTATAGATTTTTGGGTGCTATT
                      ____________________________________________________________
consensus TACTTGTATTATACACTACTGCTTTAATAGATCACGTTTTATAGATTTTTGGGTGCTATT
 
. : . : . : . : . : . :
rJMSF001A08+ CTCTATTATTTCTTCTGTGGTTGTATTGTATGCAGACCTCCCCCCAAGTAAAGATCATCT
                      ____________________________________________________________
consensus CTCTATTATTTCTTCTGTGGTTGTATTGTATGCAGACCTCCCCCCAAGTAAAGATCATCT
 
. : . : . : . : . : . :
rJMSF001A08+ AATTTTGACTCTCATGTTTTGAACCATATTTTTTCTAAGGCTTTTGAGTTGTAATTCTTG
                      ____________________________________________________________
consensus AATTTTGACTCTCATGTTTTGAACCATATTTTTTCTAAGGCTTTTGAGTTGTAATTCTTG