Previous Contig 011126:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF051P15Sequence624006894 (2)gb:AF134051_17709845e-67Solanum tuberosum fructose-1,6-bisphosphatase precursor, mRNA, nuclear gene enco581011126 (2)gb:AF378925_17934888e-52Pisum sativum fructose-1,6-bisphosphatase gene, complete cds; nuclear gene for c
JMSF033K12Sequence712006894 (2)gb:AF134051_17709842e-77Solanum tuberosum fructose-1,6-bisphosphatase precursor, mRNA, nuclear gene enco737011126 (2)sp|O64422|F16P_ORYSA1e-88Fructose-1,6-bisphosphatase, chloroplast precursor (EC 3.1.3.11) (D- fructose-1,

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF033K12+ CTGAGCTTGACC
                      ____________________________________________________________
consensus CTGAGCTTGACC
 
. : . : . : . : . : . :
rJMSF033K12+ AAGGGAAACAGAAATGTGTAGTGAGTGTGTGCCAGCCAGGGGATAACCTCCTCGCAGCAG
                      ____________________________________________________________
consensus AAGGGAAACAGAAATGTGTAGTGAGTGTGTGCCAGCCAGGGGATAACCTCCTCGCAGCAG
 
. : . : . : . : . : . :
rJMSF033K12+ GCTATTGCATGTACTCGAGCTCTGTGATCTTCGTTCTCACCTTGGGAAAAGGCGTTTTCG
                      ____________________________________________________________
consensus GCTATTGCATGTACTCGAGCTCTGTGATCTTCGTTCTCACCTTGGGAAAAGGCGTTTTCG
 
. : . : . : . : . : . :
rJMSF033K12+ CCTTCACCTTGGACCCTATGTATGGCGAATTCGTTCTTACCCAAGAAATCATTCAGATCC
                      ____________________________________________________________
consensus CCTTCACCTTGGACCCTATGTATGGCGAATTCGTTCTTACCCAAGAAATCATTCAGATCC
 
. : . : . : . : . : . :
rJMSF033K12+ CAAAGGCGGGAAAGATATACGCGTTTAATGAAGGGAACTACCAGCTATGGGATGATAAGT
rJMFF051P15+ ACGCGTTTAATGAAGGGAACTACCAGCTATGGGATGATAAGT
                      ____________________________________________________________
consensus CAAAGGCGGGAAAGATATACGCGTTTAATGAAGGGAACTACCAGCTATGGGATGATAAGT
 
. : . : . : . : . : . :
rJMSF033K12+ TGAAGAAGTACATTGATGACCTTAAGGACCCTGGTCCTAGTGGCAAGCCTTATTCTGCTA
rJMFF051P15+ TGAAGAAGTACATTGATGACCTTAAGGACCCTGGTCCTAGTGGCAAGCCTTATTCTGCTA
                      ____________________________________________________________
consensus TGAAGAAGTACATTGATGACCTTAAGGACCCTGGTCCTAGTGGCAAGCCTTATTCTGCTA
 
. : . : . : . : . : . :
rJMSF033K12+ GGTACATTGGCAGTTTGGTGGGAGACTTCCATAGGACTCTTTTGTATGGAGGCATTTATG
rJMFF051P15+ GGTACATTGGCAGTTTGGTGGGAGACTTCCATAGGACTCTTTTGTATGGAGGCATTTATG
                      ____________________________________________________________
consensus GGTACATTGGCAGTTTGGTGGGAGACTTCCATAGGACTCTTTTGTATGGAGGCATTTATG
 
. : . : . : . : . : . :
rJMSF033K12+ GGTACCCAAGAGACAAGAAGAGCAAGAACGGGAAGCTAAGGCTTCTGTACGAGTGTGCCC
rJMFF051P15+ GGTACCCAAGAGACAAGAAGAGCAAGAACGGGAAGCTAAGGCTTCTGTACGAGTGTGCCC
                      ____________________________________________________________
consensus GGTACCCAAGAGACAAGAAGAGCAAGAACGGGAAGCTAAGGCTTCTGTACGAGTGTGCCC
 
. : . : . : . : . : . :
rJMSF033K12+ CGATGAGCTTCATCGTGGAGCAAGCCGGTGGGAAAGGATCAGATGGCCATAAAAGAATTC
rJMFF051P15+ CGATGAGCTTCATCGTGGAGCAAGCCGGTGGGAAAGGATCAGATGGCCATAAAAGAATTC
                      ____________________________________________________________
consensus CGATGAGCTTCATCGTGGAGCAAGCCGGTGGGAAAGGATCAGATGGCCATAAAAGAATTC
 
. : . : . : . : . : . :
rJMSF033K12+ TTGATATCACACCAGTTGAGATACACCAGCGAGTTCCTCTATACATTGGAAGTGTGGAGG
rJMFF051P15+ TTGATATCACACCAGTTGAGATACACCAGCGAGTTCCTCTATACATTGGAAGTGTGGAGG
                      ____________________________________________________________
consensus TTGATATCACACCAGTTGAGATACACCAGCGAGTTCCTCTATACATTGGAAGTGTGGAGG
 
. : . : . : . : . : . :
rJMSF033K12+ AAGTTGATAAGTTGGAGAAGTACCTAGCTTAATCCAAGAATGAAATGCAGAGATGAGTAC
rJMFF051P15+ AAGTTGATAAGTTGGGGAAGTACCTAGCTTAATCCAAGAATGAAATGCAGAGATGAGTAC
                      ____________________________________________________________
consensus AAGTTGATAAGTTGGGGAAGTACCTAGCTTAATCCAAGAATGAAATGCAGAGATGAGTAC
 
. : . : . : . : . : . :
rJMSF033K12+ ATTGAAGCCATGGTGTTGTTTTGGACCACTCTCAGATGTATATCAGAATCTACAACTTAA
rJMFF051P15+ ATTGAAGCCATGGTGTTGTTTTGGACCACTCTCAGATGTATATCAGAATCTACAACTTAA
                      ____________________________________________________________
consensus ATTGAAGCCATGGTGTTGTTTTGGACCACTCTCAGATGTATATCAGAATCTACAACTTAA
 
. : . : . : . : . : . :
rJMSF033K12+ AATGCATTGTAAACACTTGAAAATAAAATATTATTCTTTTGATCTTTTCTGAGTCCAGGC
rJMFF051P15+ AATGCATTGTAAACACTTGAAAATAAAATATTATTCTTTTGATCTTTTCTGAGT-CAGGC
                      ____________________________________________________________
consensus AATGCATTGTAAACACTTGAAAATAAAATATTATTCTTTTGATCTTTTCTGAGTCCAGGC
 
. : . : . : . : . : . :
rJMSF033K12+ AAAAT
rJMFF051P15+ AAAATGATTGTAGATGTTCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus AAAATGATTGTAGATGTTCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG