Previous Contig 011123:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF051P09Sequence491011123 (2)523011123 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF051P09- ACATCCTCGCACCCTTCAATCAGACAACAATCGGAGATATTGGTGGTTTG
rJMFF051P09+ CGCACCCTTCAATCAGACAACAATCGGAGATATGGGTGGTTTG
                      ____________________________________________________________
consensus ACATCCTCGCACCCTTCAATCAGACAACAATCGGAGATATTGGTGGTTTG
 
. : . : . : . : . : . :
JMFF051P09- GTGGCTGTTGGAGAAATTGAGAATGACTCGGGGAAACCAGAGAGAAAGGGATAGGGAAAG
rJMFF051P09+ GTGGCTGTTGGAGAAATTGAGAATGACTCGGGGAAACCAGAGAGAAAGGGATAGGGAAAG
                      ____________________________________________________________
consensus GTGGCTGTTGGAGAAATTGAGAATGACTCGGGGAAACCAGAGAGAAAGGGATAGGGAAAG
 
. : . : . : . : . : . :
JMFF051P09- GGCTCAAGCAAGGGCAGGCCACAAGCCCAAGCAGTCTAAAGGCGATGGATTGACCCCCGA
rJMFF051P09+ GGCTCAAGCAAGGGCAGGCCACAAGCCCAAGCAGTCTAAAGGCGATGGATTGACCCCCGA
                      ____________________________________________________________
consensus GGCTCAAGCAAGGGCAGGCCACAAGCCCAAGCAGTCTAAAGGCGATGGATTGACCCCCGA
 
. : . : . : . : . : . :
JMFF051P09- GCAAAGACGAGAGAGGTGAAATTTTATTTTATTTTTTGAGATTTTGATTTGTGTGATTAG
rJMFF051P09+ GCAAAGACGAGAGAGGTGAAATTTTATTTTATTTTTTGAGATTTTGATTTGTGTGATTAG
                      ____________________________________________________________
consensus GCAAAGACGAGAGAGGTGAAATTTTATTTTATTTTTTGAGATTTTGATTTGTGTGATTAG
 
. : . : . : . : . : . :
JMFF051P09- TAATTACAAAATTGTGATGCCATGGAATGGAATCAGGGACGCAAAGGCACTTCAAGAAAA
rJMFF051P09+ TAATTACAAAATTGTGATGCCATGGAATGGAATCAGGGACGCAAAGGCACTTCAAGAAAA
                      ____________________________________________________________
consensus TAATTACAAAATTGTGATGCCATGGAATGGAATCAGGGACGCAAAGGCACTTCAAGAAAA
 
. : . : . : . : . : . :
JMFF051P09- GGCAGCTAGGAAAGCGGCGGCTCGAGGGAACAATACTACCAATAATAAATAGTGTACCGG
rJMFF051P09+ GGCAGCTAGGAAAGCGGCGGCTCGAGGGAACAATACTACCAATAATAAATAGTGTACCGG
                      ____________________________________________________________
consensus GGCAGCTAGGAAAGCGGCGGCTCGAGGGAACAATACTACCAATAATAAATAGTGTACCGG
 
. : . : . : . : . : . :
JMFF051P09- ATTGGGCAGTCGCCGGTGTTTGTAAAATTTAATTTAATTTGTTGTGTCTGCTGTGGCCAT
rJMFF051P09+ ATTGGGCAGTCGCCGGTGTTTGTAAAATTTAATTTAATTTGTTGTGTCTGCTGTGGCCAT
                      ____________________________________________________________
consensus ATTGGGCAGTCGCCGGTGTTTGTAAAATTTAATTTAATTTGTTGTGTCTGCTGTGGCCAT
 
. : . : . : . : . : . :
JMFF051P09- TTGTTGTCTTTTCGACCATTAACTTGTTGTAACTCAAAACTCATTTTGAACAAAATTTCC
rJMFF051P09+ TTGTTGTCTTTTCGACCATTAACTTGTTGTAACTCAAAACTCATTTTGAACAAAATTTCC
                      ____________________________________________________________
consensus TTGTTGTCTTTTCGACCATTAACTTGTTGTAACTCAAAACTCATTTTGAACAAAATTTCC
 
. : . : . : . : . : . :
JMFF051P09- TGTTATTCTTTTTAAAACTA
rJMFF051P09+ TGTTATTCTTTTTAAAACTAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus TGTTATTCTTTTTAAAACTAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG