Previous Contig 011121:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002A21Sequence356002222 (3)gb:AB018112_15137783e-13Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAB16.420011121 (6)gb:AB061258_15220195e-20Solanum tuberosum mRNA for cytochrome P450, partial cds.
JMFF020F22Sequence535002222 (3)gb:AB018112_15137786e-29Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAB16.677011121 (6)gb:AB018112_15137747e-62Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAB16.
JMFF051P02Sequence596002222 (3)gb:AB018112_15137786e-27Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAB16.503011121 (6)gb:AB018112_15137748e-33Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAB16.
JMFN040F12Sequence517011121 (6)gb:AB018112_15137746e-60Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAB16.
JMSF015H09Sequence583011121 (6)gb:AB018112_15137743e-37Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAB16.783011121 (6)gb:AB018112_15137747e-68Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAB16.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF015H09- GGTTCTTGAGCATTGAG
                      ____________________________________________________________
consensus GGTTCTTGAGCATTGAG
 
. : . : . : . : . : . :
JMSF015H09- GACCGCGACGAGGTTAAAAGGTTGTTAGACCCAATAATCCTCGTTAGCACAGGCATGTTC
                      ____________________________________________________________
consensus GACCGCGACGAGGTTAAAAGGTTGTTAGACCCAATAATCCTCGTTAGCACAGGCATGTTC
 
. : . : . : . : . : . :
JMSF015H09- AGCCTGCCACTCAACTTCCCCGGCACGGCCTACAATCGCGCCATGAAAGGCGGTAGCATG
                      ____________________________________________________________
consensus AGCCTGCCACTCAACTTCCCCGGCACGGCCTACAATCGCGCCATGAAAGGCGGTAGCATG
 
. : . : . : . : . : . :
JMSF015H09- GTGCGCCGTCAGCTCGTGGAGGTGATTAAGGAGAGGAAGGCAAAGGCGATGATGAATAGT
                      ____________________________________________________________
consensus GTGCGCCGTCAGCTCGTGGAGGTGATTAAGGAGAGGAAGGCAAAGGCGATGATGAATAGT
 
. : . : . : . : . : . :
JMSF015H09- TTAGGTAAGGTGGAGGATGAGGGGCGAGACGTGTTGGGTCGCCTCCTTAGCGTCACCGAT
rJMSF015H09+ CGTCACCGAT
                      ____________________________________________________________
consensus TTAGGTAAGGTGGAGGATGAGGGGCGAGACGTGTTGGGTCGCCTCCTTAGCGTCACCGAT
 
. : . : . : . : . : . :
JMSF015H09- GAGGAGGGACAACACTTGAACGAGTTCGAGATTTACCATTATATTATCGGAATTCTCCTC
rJMSF015H09+ GAGGAGGGACAACACTTGAACGAGNTCGAGATTTACCATTATATTATCGGAATTCTCCTC
                      ____________________________________________________________
consensus GAGGAGGGACAACACTTGAACGAGTTCGAGATTTACCATTATATTATCGGAATTCTCCTC
 
. : . : . : . : . : . :
JMSF015H09- CCCACCTACCATTCTATCAGTGCCGCCATAACCTTTGTATTGAAGTTTCTTGCTGAACTT
JMFN040F12- GCCGCCATAACCTTTGTATTGAAGTTTCTTGCTGAACTT
rJMSF015H09+ CCCACCTACCATTCTATCAGTGCCGCCATAACCTTTGTATTGAAGTTTCTTGCTGAACTT
rJMFF020F22+ CTT
                      ____________________________________________________________
consensus CCCACCTACCATTCTATCAGTGCCGCCATAACCTTTGTATTGAAGTTTCTTGCTGAACTT
 
. : . : . : . : . : . :
JMSF015H09- CCCCATATTTATCAACAAGTCTACAAAGAACAAATTGAAATTGCCAAGTCGAAGGGACCA
JMFN040F12- CCCCATATTTATCAACAAGCCTACAAAGAACAAATTGAAATTGCCAAGTCCACCGNNCCA
rJMSF015H09+ CCCCATATTTATCAACAAGTCTACAAAGAACAAATTGAAATTGCCAAGTCGAAGGGACCA
rJMFF020F22+ CCCCATATTTATCAACAAGTCTACAAAGAACAAATTGAAATTGCCAAGTCGAAGGGACCA
                      ____________________________________________________________
consensus CCCCATATTTATCAACAAGTCTACAAAGAACAAATTGAAATTGCCAAGTCGAAGGGACCA
 
. : . : . : . : . : . :
JMSF015H09- AATGAGAGATTAAGTTGGGAAGACATTCAAAAGATGAAATATTCATGGAATGTGGCATGT
JMFN040F12- AATGAGAGATTAAGTTGGGAAGACATTCAAAAGATGAAATATTCATGGAATGTGGCATGT
rJMSF015H09+ AATGAGAGATTAAGTTGGGAAGACATTCAAAAGATGAAATATTCATGGAATGTGGCATGT
rJMFF020F22+ AATGAGAGATTAAGTTGGGAAGACATTCAAAAGATGAAATATTCATGGAATGTGGCATGT
                      ____________________________________________________________
consensus AATGAGAGATTAAGTTGGGAAGACATTCAAAAGATGAAATATTCATGGAATGTGGCATGT
 
. : . : . : . : . : . :
JMSF015H09- GAAGCACTAAGGCTATTCCCACCAGGACAAGGTGGCTTTAGAGAGACTGTCACTGATTTT
JMFN040F12- GAAGCACTAAGGCTATTCCCACCAGGACAAGGTGGCTTTAGAGAGACTGTCACTGATTTT
rJMSF015H09+ GAAGCACTAAGGCTATTCCCACCAGGACAAGGTGGCTTTAGAGAGACTGTCACTGATTTT
rJMFF020F22+ GAAGCACTAAGGCTATTCCCACCAGGACAAGGTGGCTTTAGAGAGACTGTCACTGATTTT
                      ____________________________________________________________
consensus GAAGCACTAAGGCTATTCCCACCAGGACAAGGTGGCTTTAGAGAGACTGTCACTGATTTT
 
. : . : . : . : . : . :
JMSF015H09- ACCTACGCTGGATTTACTATCCCAAA
JMFN040F12- ACCTACGCTGGATTTACTATCCCAAAAGGATGGAAGACATTTTGGAATGTGTATTCAACA
rJMSF015H09+ ACCTACGCTGGATTTACTATCCCAAAAGGATGGAAGACATTTTGGAATGTGTATTCAACA
rJMFF002A21+ TATCCCAAAAGGATGGAAGACATTTTGGAATGTGTATTCNACN
rJMFF020F22+ ACCTACGCTGGATTTACTATCCCAAAAGGATGGAAGACATTTTGGAATGTGTATTCAACA
rJMFF051P02+ CATTTTGGAATGTGTATTCAACA
                      ____________________________________________________________
consensus ACCTACGCTGGATTTACTATCCCAAAAGGATGGAAGACATTTTGGAATGTGTATTCAACA
 
. : . : . : . : . : . :
JMFN040F12- CACAAGAATCCCAAATATTTCTCAGAACCAGATAAATTTGATCCATCCAGGTACGAGGGA
rJMSF015H09+ CACAAGAATCCCAAATATTTCTCAGAACCAGATAAATTTGATCCATCGAGGTACGAGGGA
rJMFF002A21+ CACAAGAATCCCAAATATTTCTCAGANCCAGATAAATTTGATCCATNGAGGTNNGAGGGA
rJMFF020F22+ CACAAGAATCCCAAATATTTCTCAGAACCAGATAAATTTGATCCATCGAGGTACGAGGGA
rJMFF051P02+ CACAAGAATCCCAAATATTTCTCAGAACCAGATAAATTTGATCCATCGAGGTACGAGGGA
                      ____________________________________________________________
consensus CACAAGAATCCCAAATATTTCTCAGAACCAGATAAATTTGATCCATCGAGGTACGAGGGA
 
. : . : . : . : . : . :
JMFN040F12- AATGGGCCGGCACCCTTCACCTTTGTGCCATTTGGCGGTGGGCCGAGAATGTGTCCCGGA
rJMSF015H09+ AATGGGCCGGCACCCTTCACCTTTGTGCCATTTGGCGGTGGGCCGAGAATGTGTCCCGGA
rJMFF002A21+ AATGGGCCGGCACCCTTCACCTTTGTGCCATTTGG-NTTGGNCCGAGAATGTGTCCCGGA
rJMFF020F22+ AATGGGCCGGCACCCTTCACCTTTGTGCCATTTGGCGGTGGGCCGAGAATGTGTCCCGGA
rJMFF051P02+ AATGGGCCGGCACCCTTCACCTTTGTGCCATTTGGCGGTGGGCCGAGAATGTGTCCCGGA
                      ____________________________________________________________
consensus AATGGGCCGGCACCCTTCACCTTTGTGCCATTTGGCGGTGGGCCGAGAATGTGTCCCGGA
 
. : . : . : . : . : . :
JMFN040F12- AAAGAGTACGCCCGGCTAAAAGTACTTGTGTTCATGCACAACGTTGTCACCAACTTCAAA
rJMSF015H09+ AAAGAGTACGCCCGGCTAGAAGTACTTGTGTTCATGCACAACGTTGTCACCAACTTCAAA
rJMFF002A21+ AAAGAGTACGCCCGGNTAGAAGTACTTGTGTTCATGCACAACGTTGTCACCNANTTCAAA
rJMFF020F22+ AAAGAGTACGCCCGGCTAGAAGTACTTGTGTTCATGCACAACGTTGTCACCAACTTCAAA
rJMFF051P02+ AAAGAGTACGCCCGGCTAGAAGTACTTGTGTTCATGCACAACGTTGTCACCAACTTCAAA
                      ____________________________________________________________
consensus AAAGAGTACGCCCGGCTAGAAGTACTTGTGTTCATGCACAACGTTGTCACCAACTTCAAA
 
. : . : . : . : . : . :
JMFN040F12- ATGGAGAAACTATTGCCGAATGAGAAGATAGTCTATAATAG
rJMSF015H09+ ATGGAGAAACTAGTGCCGAATGAGAAGATAGTCTATAATAGTGCATCGCCAATTCCAGTC
rJMFF002A21+ ATGGAGAAACTAGTGCNGAATGAGAAGATAGTCTATAATAGTGCATCGCCAATTCCAGTC
rJMFF020F22+ ATGGAGAAACTAGTGCCGAATGAGAAGATAGTCTATAATAGTGCATCGCCAATTCCAGTC
rJMFF051P02+ ATGGAGAATCTAGTGCCGAATGAGAAGATAGTCTATAATAGTGCATCGCCAATTCCAGTC
                      ____________________________________________________________
consensus ATGGAGAAACTAGTGCCGAATGAGAAGATAGTCTATAATAGTGCATCGCCAATTCCAGTC
 
. : . : . : . : . : . :
rJMSF015H09+ AATGGCCTTCCTGTCAGACTTACACCCCATCAGAACTAACTTTTTGTTGCACTGCAATGA
rJMFF002A21+ AATGGCCTTCCTGTCAGACTTACACCCCATCAGAANTAACTTNTNGTTGCANTGCAATGA
rJMFF020F22+ AATGGCCTTCCTGTCAGACTTACACCCCATCAGAACTAACTTTTTGTTGCACTGCAATGA
rJMFF051P02+ AATGGCCTTCCTGTCAGACTTACACCCCATCAGAACTAACTTTTTGTTGCACTGCAATGA
                      ____________________________________________________________
consensus AATGGCCTTCCTGTCAGACTTACACCCCATCAGAACTAACTTTTTGTTGCACTGCAATGA
 
. : . : . : . : . : . :
rJMSF015H09+ CGTTAAGAGTCAATGATGTTAGTGCTTAATTGAAATAAATTTGTGTTGGTAAGTTGTATT
rJMFF002A21+ CGTTAAGAGTCAATGATGTTAGNGNNTAATTGAAATAAATTTGTGTTGGTAAGTTGTATT
rJMFF020F22+ CGTTAAGAGTCAATGATGTTAGTGCTTAATTGAAATAAATTTGTGTTGGTAAGTTGTATT
rJMFF051P02+ CGTTAAGAGTCAATGATGTTAGTGCTTAATTGAAATAAATTTGTGTTGGTAAGTTGTATT
                      ____________________________________________________________
consensus CGTTAAGAGTCAATGATGTTAGTGCTTAATTGAAATAAATTTGTGTTGGTAAGTTGTATT
 
. : . : . : . : . : . :
rJMSF015H09+ AAGTGTTTATTATTTGTGTTATTTGTATTTGACAATAATAATG-TACCCGAACC
rJMFF002A21+ AAGTGTTTATTATNTGTG
rJMFF020F22+ AAGTGTTTATTATTTGTGTTATTTGTATTTGACAATAATAATGTTACCCGAACCGTA-TT
rJMFF051P02+ AAGTGTTTATTATTTGTGTTATTTGTATTTGACAATAATAATGTTACCCGAACCGTATTT
                      ____________________________________________________________
consensus AAGTGTTTATTATTTGTGTTATTTGTATTTGACAATAATAATGTTACCCGAACCGTATTT
 
. : . : . : . : . : . :
rJMFF020F22+ GTAAAGAAGTAGTT
rJMFF051P02+ GTAAAGAAGTAGTTTGTATTGCTGAGTTCTAAGTAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus GTAAAGAAGTAGTTTGTATTGCTGAGTTCTAAGTAAAAAAAAAAAAAAACTCTCCAGGGT